Incidental Mutation 'R3052:Acsl1'
ID264991
Institutional Source Beutler Lab
Gene Symbol Acsl1
Ensembl Gene ENSMUSG00000018796
Gene Nameacyl-CoA synthetase long-chain family member 1
SynonymsFacl2, Acas1
MMRRC Submission 040561-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.272) question?
Stock #R3052 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location46471037-46536051 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 46521337 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 330 (V330I)
Ref Sequence ENSEMBL: ENSMUSP00000106001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034046] [ENSMUST00000110371] [ENSMUST00000110372]
Predicted Effect probably benign
Transcript: ENSMUST00000034046
AA Change: V330I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000034046
Gene: ENSMUSG00000018796
AA Change: V330I

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
Pfam:AMP-binding 97 564 7.9e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110371
SMART Domains Protein: ENSMUSP00000106000
Gene: ENSMUSG00000018796

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
Pfam:AMP-binding 97 564 4.1e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110372
AA Change: V330I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000106001
Gene: ENSMUSG00000018796
AA Change: V330I

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
Pfam:AMP-binding 101 564 9.7e-104 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210929
Meta Mutation Damage Score 0.1235 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to a family of acyl coenzyme A synthetase proteins, which convert long chain fatty acids to acyl CoA products via an ATP-dependent pathway. This enzyme is enriched in heart, liver and adipose tissue, where it functions in lipid synthesis and mitochondrial and peroxisomal beta-oxidation. In addition, it is expressed in monocytes and macrophages where it appears to have a functionally distinct role in mediating inflammatory and innate immune responses. A pseudogene of this gene is found on chromosome 5. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Liver acyl-CoA levels are reduced when this gene is conditionally knocked out in the liver. Impaired adaptive thermogenesis when this gene is conditionally knocked out in adipose tissue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 T C 16: 35,303,716 L1255P probably damaging Het
Ampd2 C T 3: 108,086,487 probably benign Het
Asb18 T A 1: 89,992,985 H149L probably damaging Het
Atp8b1 T C 18: 64,553,108 E668G probably benign Het
Axdnd1 T C 1: 156,341,870 T809A probably damaging Het
B430306N03Rik T C 17: 48,316,910 S80P probably damaging Het
Banp G A 8: 122,005,687 probably null Het
Capn2 G A 1: 182,487,772 T306M probably benign Het
Ccpg1 A T 9: 73,005,868 S229C probably damaging Het
Cep250 G T 2: 155,991,048 S1630I probably damaging Het
Ces1g C A 8: 93,335,048 V77L possibly damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col6a3 T A 1: 90,802,130 H1211L possibly damaging Het
Cyp2a5 A G 7: 26,842,985 I471V possibly damaging Het
Gm10384 A G 15: 36,871,752 noncoding transcript Het
Gm973 T C 1: 59,633,140 probably benign Het
Ift88 C T 14: 57,430,568 P9S probably damaging Het
Mfsd2a A G 4: 122,951,842 L172P probably damaging Het
Nav3 T A 10: 109,903,752 I119F probably damaging Het
Nbeal2 T C 9: 110,633,085 E1428G possibly damaging Het
Olfr1126 C A 2: 87,457,903 T246K probably damaging Het
Phf13 T C 4: 151,992,363 D124G possibly damaging Het
Ppp3ca T G 3: 136,797,844 S59R probably benign Het
Rsu1 A G 2: 13,170,135 probably benign Het
Rttn T C 18: 89,015,246 probably benign Het
Ryr1 A T 7: 29,053,090 V3598E probably damaging Het
Sc5d G T 9: 42,255,570 N224K probably damaging Het
Tacc2 G A 7: 130,625,496 E1323K possibly damaging Het
Tbc1d21 T A 9: 58,363,069 D141V probably damaging Het
Trp53bp2 T C 1: 182,453,782 F983L probably damaging Het
Ubxn2a T A 12: 4,891,322 K95* probably null Het
Ugt3a2 G T 15: 9,365,288 W329L probably damaging Het
Unk T C 11: 116,050,123 Y237H probably benign Het
Vcam1 A C 3: 116,124,430 probably null Het
Xpo6 T C 7: 126,104,721 N1086D probably damaging Het
Zc3h12c A T 9: 52,144,056 L132Q possibly damaging Het
Other mutations in Acsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Acsl1 APN 8 46513760 unclassified probably benign
IGL01356:Acsl1 APN 8 46511463 critical splice donor site probably null
IGL02227:Acsl1 APN 8 46534365 missense probably benign 0.40
IGL02812:Acsl1 APN 8 46492836 missense possibly damaging 0.47
IGL03061:Acsl1 APN 8 46508337 missense probably damaging 0.97
IGL03329:Acsl1 APN 8 46492994 missense possibly damaging 0.88
R0019:Acsl1 UTSW 8 46521250 intron probably null
R0190:Acsl1 UTSW 8 46513392 critical splice donor site probably null
R0233:Acsl1 UTSW 8 46513569 unclassified probably benign
R0479:Acsl1 UTSW 8 46531072 missense probably damaging 1.00
R1325:Acsl1 UTSW 8 46513300 missense probably benign
R1930:Acsl1 UTSW 8 46530986 missense probably benign 0.21
R1931:Acsl1 UTSW 8 46530986 missense probably benign 0.21
R2035:Acsl1 UTSW 8 46528584 missense probably damaging 1.00
R2126:Acsl1 UTSW 8 46533626 missense probably benign 0.01
R2167:Acsl1 UTSW 8 46533590 missense possibly damaging 0.91
R3051:Acsl1 UTSW 8 46521337 missense probably benign 0.00
R3753:Acsl1 UTSW 8 46513565 unclassified probably benign
R3883:Acsl1 UTSW 8 46527191 missense probably benign 0.19
R3956:Acsl1 UTSW 8 46534458 missense probably damaging 1.00
R4622:Acsl1 UTSW 8 46526373 missense probably benign 0.02
R5012:Acsl1 UTSW 8 46521431 missense probably benign 0.01
R5168:Acsl1 UTSW 8 46513266 unclassified probably benign
R5464:Acsl1 UTSW 8 46505738 missense probably benign
R5678:Acsl1 UTSW 8 46492850 missense probably benign 0.03
R7151:Acsl1 UTSW 8 46513597 missense probably damaging 1.00
R7831:Acsl1 UTSW 8 46519006 missense probably benign 0.01
R7914:Acsl1 UTSW 8 46519006 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGCTATGCTTGGTCATCAGG -3'
(R):5'- TTCCAACAACCTGTGCTGC -3'

Sequencing Primer
(F):5'- GGTAGAGCACTTCTTAACATGTGCAC -3'
(R):5'- CCGAGTGAAGAACCGTGTGTATG -3'
Posted On2015-02-05