Incidental Mutation 'R3052:Ces1g'
ID264993
Institutional Source Beutler Lab
Gene Symbol Ces1g
Ensembl Gene ENSMUSG00000057074
Gene Namecarboxylesterase 1G
SynonymsSes-1, Ces1, Ces-1
MMRRC Submission 040561-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R3052 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location93302369-93337308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 93335048 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 77 (V77L)
Ref Sequence ENSEMBL: ENSMUSP00000037555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044602]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044602
AA Change: V77L

PolyPhen 2 Score 0.497 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000037555
Gene: ENSMUSG00000057074
AA Change: V77L

DomainStartEndE-ValueType
Pfam:COesterase 1 545 3.6e-168 PFAM
Pfam:Abhydrolase_3 136 295 5.7e-11 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They may participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. This enzyme is the major liver enzyme and functions in liver drug clearance. The expression and activity of this gene is age-related but independent of growth hormone level. This gene is clustered with Ces7 and Ces3 on chromosome 8. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 G A 8: 46,521,337 V330I probably benign Het
Adcy5 T C 16: 35,303,716 L1255P probably damaging Het
Ampd2 C T 3: 108,086,487 probably benign Het
Asb18 T A 1: 89,992,985 H149L probably damaging Het
Atp8b1 T C 18: 64,553,108 E668G probably benign Het
Axdnd1 T C 1: 156,341,870 T809A probably damaging Het
B430306N03Rik T C 17: 48,316,910 S80P probably damaging Het
Banp G A 8: 122,005,687 probably null Het
Capn2 G A 1: 182,487,772 T306M probably benign Het
Ccpg1 A T 9: 73,005,868 S229C probably damaging Het
Cep250 G T 2: 155,991,048 S1630I probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col6a3 T A 1: 90,802,130 H1211L possibly damaging Het
Cyp2a5 A G 7: 26,842,985 I471V possibly damaging Het
Gm10384 A G 15: 36,871,752 noncoding transcript Het
Gm973 T C 1: 59,633,140 probably benign Het
Ift88 C T 14: 57,430,568 P9S probably damaging Het
Mfsd2a A G 4: 122,951,842 L172P probably damaging Het
Nav3 T A 10: 109,903,752 I119F probably damaging Het
Nbeal2 T C 9: 110,633,085 E1428G possibly damaging Het
Olfr1126 C A 2: 87,457,903 T246K probably damaging Het
Phf13 T C 4: 151,992,363 D124G possibly damaging Het
Ppp3ca T G 3: 136,797,844 S59R probably benign Het
Rsu1 A G 2: 13,170,135 probably benign Het
Rttn T C 18: 89,015,246 probably benign Het
Ryr1 A T 7: 29,053,090 V3598E probably damaging Het
Sc5d G T 9: 42,255,570 N224K probably damaging Het
Tacc2 G A 7: 130,625,496 E1323K possibly damaging Het
Tbc1d21 T A 9: 58,363,069 D141V probably damaging Het
Trp53bp2 T C 1: 182,453,782 F983L probably damaging Het
Ubxn2a T A 12: 4,891,322 K95* probably null Het
Ugt3a2 G T 15: 9,365,288 W329L probably damaging Het
Unk T C 11: 116,050,123 Y237H probably benign Het
Vcam1 A C 3: 116,124,430 probably null Het
Xpo6 T C 7: 126,104,721 N1086D probably damaging Het
Zc3h12c A T 9: 52,144,056 L132Q possibly damaging Het
Other mutations in Ces1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Ces1g APN 8 93302987 missense possibly damaging 0.61
IGL00971:Ces1g APN 8 93303032 missense probably damaging 1.00
IGL01583:Ces1g APN 8 93306959 missense probably damaging 1.00
IGL02993:Ces1g APN 8 93317079 missense probably benign 0.00
IGL03386:Ces1g APN 8 93325812 missense probably benign 0.00
R0359:Ces1g UTSW 8 93328535 splice site probably benign
R0373:Ces1g UTSW 8 93331193 missense probably benign 0.06
R0499:Ces1g UTSW 8 93333689 missense probably benign 0.01
R0689:Ces1g UTSW 8 93328407 missense probably damaging 1.00
R1756:Ces1g UTSW 8 93306954 missense probably benign 0.03
R3150:Ces1g UTSW 8 93325816 missense probably benign 0.45
R3899:Ces1g UTSW 8 93303050 missense probably damaging 1.00
R3966:Ces1g UTSW 8 93328511 missense possibly damaging 0.50
R4134:Ces1g UTSW 8 93319872 missense probably benign 0.00
R4198:Ces1g UTSW 8 93305868 missense probably benign 0.11
R4332:Ces1g UTSW 8 93319818 missense probably benign 0.01
R4719:Ces1g UTSW 8 93317090 missense possibly damaging 0.59
R4841:Ces1g UTSW 8 93333695 missense probably benign 0.01
R4842:Ces1g UTSW 8 93333695 missense probably benign 0.01
R4843:Ces1g UTSW 8 93331265 missense probably damaging 1.00
R5344:Ces1g UTSW 8 93337193 start gained probably benign
R5405:Ces1g UTSW 8 93305868 missense probably benign 0.29
R5425:Ces1g UTSW 8 93325800 missense probably benign 0.20
R5884:Ces1g UTSW 8 93306930 missense probably benign 0.24
R6022:Ces1g UTSW 8 93328457 missense probably damaging 1.00
R6183:Ces1g UTSW 8 93331239 missense possibly damaging 0.48
R6197:Ces1g UTSW 8 93337136 missense probably benign 0.01
R6307:Ces1g UTSW 8 93331192 missense possibly damaging 0.60
R6688:Ces1g UTSW 8 93306972 missense possibly damaging 0.92
R6863:Ces1g UTSW 8 93317019 missense possibly damaging 0.92
R7097:Ces1g UTSW 8 93317037 missense possibly damaging 0.89
R7122:Ces1g UTSW 8 93317037 missense possibly damaging 0.89
R7180:Ces1g UTSW 8 93302948 missense probably benign 0.04
R7202:Ces1g UTSW 8 93302967 missense probably benign 0.01
R7361:Ces1g UTSW 8 93333679 missense not run
R7537:Ces1g UTSW 8 93319827 missense probably benign 0.01
R7621:Ces1g UTSW 8 93328466 missense probably damaging 1.00
Z1176:Ces1g UTSW 8 93325811 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCAAAAGTCATTTAAGACCCACATG -3'
(R):5'- TCTCTTGTCAAACAGGACACCC -3'

Sequencing Primer
(F):5'- TGATGCCCACTTGGTGAAAC -3'
(R):5'- CATCCTTACCGCCTGTGGTAC -3'
Posted On2015-02-05