Incidental Mutation 'R3052:Sc5d'
ID264994
Institutional Source Beutler Lab
Gene Symbol Sc5d
Ensembl Gene ENSMUSG00000032018
Gene Namesterol-C5-desaturase
Synonyms
MMRRC Submission 040561-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3052 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location42251595-42264256 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 42255570 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 224 (N224K)
Ref Sequence ENSEMBL: ENSMUSP00000130438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052725] [ENSMUST00000169609] [ENSMUST00000217513]
Predicted Effect probably damaging
Transcript: ENSMUST00000052725
AA Change: N224K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057354
Gene: ENSMUSG00000032018
AA Change: N224K

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
Pfam:FA_hydroxylase 123 234 9.9e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169609
AA Change: N224K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130438
Gene: ENSMUSG00000032018
AA Change: N224K

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
Pfam:FA_hydroxylase 123 253 6.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217513
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme of cholesterol biosynthesis. The encoded protein catalyzes the conversion of lathosterol into 7-dehydrocholesterol. Mutations in this gene have been associated with lathosterolosis. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice died perinatally with increased lathosterol and decreased cholesterol levels. Additionaly, mutant mice presented with bone malformations of the limbs and skull. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 G A 8: 46,521,337 V330I probably benign Het
Adcy5 T C 16: 35,303,716 L1255P probably damaging Het
Ampd2 C T 3: 108,086,487 probably benign Het
Asb18 T A 1: 89,992,985 H149L probably damaging Het
Atp8b1 T C 18: 64,553,108 E668G probably benign Het
Axdnd1 T C 1: 156,341,870 T809A probably damaging Het
B430306N03Rik T C 17: 48,316,910 S80P probably damaging Het
Banp G A 8: 122,005,687 probably null Het
Capn2 G A 1: 182,487,772 T306M probably benign Het
Ccpg1 A T 9: 73,005,868 S229C probably damaging Het
Cep250 G T 2: 155,991,048 S1630I probably damaging Het
Ces1g C A 8: 93,335,048 V77L possibly damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col6a3 T A 1: 90,802,130 H1211L possibly damaging Het
Cyp2a5 A G 7: 26,842,985 I471V possibly damaging Het
Gm10384 A G 15: 36,871,752 noncoding transcript Het
Gm973 T C 1: 59,633,140 probably benign Het
Ift88 C T 14: 57,430,568 P9S probably damaging Het
Mfsd2a A G 4: 122,951,842 L172P probably damaging Het
Nav3 T A 10: 109,903,752 I119F probably damaging Het
Nbeal2 T C 9: 110,633,085 E1428G possibly damaging Het
Olfr1126 C A 2: 87,457,903 T246K probably damaging Het
Phf13 T C 4: 151,992,363 D124G possibly damaging Het
Ppp3ca T G 3: 136,797,844 S59R probably benign Het
Rsu1 A G 2: 13,170,135 probably benign Het
Rttn T C 18: 89,015,246 probably benign Het
Ryr1 A T 7: 29,053,090 V3598E probably damaging Het
Tacc2 G A 7: 130,625,496 E1323K possibly damaging Het
Tbc1d21 T A 9: 58,363,069 D141V probably damaging Het
Trp53bp2 T C 1: 182,453,782 F983L probably damaging Het
Ubxn2a T A 12: 4,891,322 K95* probably null Het
Ugt3a2 G T 15: 9,365,288 W329L probably damaging Het
Unk T C 11: 116,050,123 Y237H probably benign Het
Vcam1 A C 3: 116,124,430 probably null Het
Xpo6 T C 7: 126,104,721 N1086D probably damaging Het
Zc3h12c A T 9: 52,144,056 L132Q possibly damaging Het
Other mutations in Sc5d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01765:Sc5d APN 9 42256168 missense probably damaging 1.00
IGL01967:Sc5d APN 9 42258634 missense possibly damaging 0.94
IGL02851:Sc5d APN 9 42255394 missense probably benign 0.00
R0116:Sc5d UTSW 9 42259859 nonsense probably null
R1520:Sc5d UTSW 9 42258650 missense probably benign 0.02
R2171:Sc5d UTSW 9 42255386 missense probably benign 0.01
R4685:Sc5d UTSW 9 42258650 missense probably benign 0.02
R4885:Sc5d UTSW 9 42255626 missense probably benign 0.05
R5138:Sc5d UTSW 9 42255515 missense probably damaging 1.00
R6244:Sc5d UTSW 9 42255421 missense probably benign 0.00
R6940:Sc5d UTSW 9 42255427 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGCCGTTTTCTGCAAAGC -3'
(R):5'- CAGATGGGTCTAACCGTATCCC -3'

Sequencing Primer
(F):5'- AGCCGTTTTCTGCAAAGCTGTTAG -3'
(R):5'- ACGCCGTTTGCAAGTCATG -3'
Posted On2015-02-05