Incidental Mutation 'R3052:Nbeal2'
ID264999
Institutional Source Beutler Lab
Gene Symbol Nbeal2
Ensembl Gene ENSMUSG00000056724
Gene Nameneurobeachin-like 2
Synonyms1110014F23Rik
MMRRC Submission 040561-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.325) question?
Stock #R3052 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location110624789-110654161 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110633085 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1428 (E1428G)
Ref Sequence ENSEMBL: ENSMUSP00000143265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000133191] [ENSMUST00000167320] [ENSMUST00000196488]
Predicted Effect probably benign
Transcript: ENSMUST00000123996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126088
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129095
Predicted Effect unknown
Transcript: ENSMUST00000130024
AA Change: E743G
SMART Domains Protein: ENSMUSP00000118061
Gene: ENSMUSG00000056724
AA Change: E743G

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
low complexity region 236 248 N/A INTRINSIC
Pfam:DUF4704 345 607 2.5e-29 PFAM
low complexity region 649 664 N/A INTRINSIC
low complexity region 804 819 N/A INTRINSIC
Pfam:DUF4800 872 1138 9.9e-113 PFAM
low complexity region 1164 1193 N/A INTRINSIC
Pfam:PH_BEACH 1204 1291 2.2e-21 PFAM
Beach 1343 1623 5.2e-205 SMART
WD40 1721 1766 1.03e1 SMART
WD40 1769 1808 6.19e-5 SMART
WD40 1820 1859 1.02e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131017
SMART Domains Protein: ENSMUSP00000114660
Gene: ENSMUSG00000056724

DomainStartEndE-ValueType
Pfam:DUF4800 1 209 7.5e-97 PFAM
low complexity region 235 264 N/A INTRINSIC
Pfam:PH_BEACH 275 362 1e-21 PFAM
Beach 414 694 5.2e-205 SMART
WD40 762 807 1.03e1 SMART
WD40 810 849 6.19e-5 SMART
WD40 861 900 1.02e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000133191
AA Change: E1455G

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000121373
Gene: ENSMUSG00000056724
AA Change: E1455G

DomainStartEndE-ValueType
low complexity region 56 84 N/A INTRINSIC
low complexity region 192 201 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
low complexity region 514 522 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
Pfam:Laminin_G_3 578 818 5.9e-8 PFAM
low complexity region 1014 1028 N/A INTRINSIC
low complexity region 1128 1136 N/A INTRINSIC
low complexity region 1149 1163 N/A INTRINSIC
low complexity region 1359 1375 N/A INTRINSIC
low complexity region 1515 1530 N/A INTRINSIC
low complexity region 1621 1647 N/A INTRINSIC
low complexity region 1875 1904 N/A INTRINSIC
Pfam:PH_BEACH 1908 2002 6.2e-28 PFAM
Beach 2054 2334 5.2e-205 SMART
WD40 2432 2477 1.03e1 SMART
WD40 2480 2519 6.19e-5 SMART
WD40 2531 2570 1.02e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153960
Predicted Effect possibly damaging
Transcript: ENSMUST00000167320
AA Change: E1462G

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000128586
Gene: ENSMUSG00000056724
AA Change: E1462G

DomainStartEndE-ValueType
low complexity region 56 84 N/A INTRINSIC
low complexity region 192 201 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
low complexity region 514 522 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
low complexity region 763 775 N/A INTRINSIC
Pfam:DUF4704 872 1148 9.2e-32 PFAM
low complexity region 1149 1163 N/A INTRINSIC
low complexity region 1366 1382 N/A INTRINSIC
low complexity region 1522 1537 N/A INTRINSIC
Pfam:DUF4800 1590 1856 1.5e-112 PFAM
low complexity region 1882 1911 N/A INTRINSIC
Pfam:PH_BEACH 1922 2009 3.1e-21 PFAM
Beach 2061 2341 5.2e-205 SMART
WD40 2439 2484 1.03e1 SMART
WD40 2487 2526 6.19e-5 SMART
WD40 2538 2577 1.02e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184024
Predicted Effect possibly damaging
Transcript: ENSMUST00000196488
AA Change: E1428G

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143265
Gene: ENSMUSG00000056724
AA Change: E1428G

DomainStartEndE-ValueType
low complexity region 56 84 N/A INTRINSIC
low complexity region 192 201 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
low complexity region 487 495 N/A INTRINSIC
low complexity region 500 515 N/A INTRINSIC
Pfam:Laminin_G_3 551 791 5.3e-6 PFAM
low complexity region 987 1001 N/A INTRINSIC
low complexity region 1101 1109 N/A INTRINSIC
low complexity region 1122 1136 N/A INTRINSIC
low complexity region 1332 1348 N/A INTRINSIC
low complexity region 1488 1503 N/A INTRINSIC
low complexity region 1594 1620 N/A INTRINSIC
low complexity region 1848 1877 N/A INTRINSIC
Pfam:PH_BEACH 1881 1975 3.1e-25 PFAM
Beach 2027 2307 3.8e-209 SMART
WD40 2405 2450 6.3e-2 SMART
WD40 2453 2492 3.8e-7 SMART
WD40 2504 2543 6.5e-8 SMART
Meta Mutation Damage Score 0.2347 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a beige and Chediak-Higashi (BEACH) domain and multiple WD40 domains, and may play a role in megakaryocyte alpha-granule biogenesis. Mutations in this gene are a cause of gray platelet syndrome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mice exhibit megakaryocyte and platelet abnormalities resulting in impaired arterial thrombus formation and protection from infarction following cerebral ischemia. Wound repair is impaired. These abnormalities result in a bleeding disorder similiar to Gray Platelet Syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 G A 8: 46,521,337 V330I probably benign Het
Adcy5 T C 16: 35,303,716 L1255P probably damaging Het
Ampd2 C T 3: 108,086,487 probably benign Het
Asb18 T A 1: 89,992,985 H149L probably damaging Het
Atp8b1 T C 18: 64,553,108 E668G probably benign Het
Axdnd1 T C 1: 156,341,870 T809A probably damaging Het
B430306N03Rik T C 17: 48,316,910 S80P probably damaging Het
Banp G A 8: 122,005,687 probably null Het
Capn2 G A 1: 182,487,772 T306M probably benign Het
Ccpg1 A T 9: 73,005,868 S229C probably damaging Het
Cep250 G T 2: 155,991,048 S1630I probably damaging Het
Ces1g C A 8: 93,335,048 V77L possibly damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col6a3 T A 1: 90,802,130 H1211L possibly damaging Het
Cyp2a5 A G 7: 26,842,985 I471V possibly damaging Het
Gm10384 A G 15: 36,871,752 noncoding transcript Het
Gm973 T C 1: 59,633,140 probably benign Het
Ift88 C T 14: 57,430,568 P9S probably damaging Het
Mfsd2a A G 4: 122,951,842 L172P probably damaging Het
Nav3 T A 10: 109,903,752 I119F probably damaging Het
Olfr1126 C A 2: 87,457,903 T246K probably damaging Het
Phf13 T C 4: 151,992,363 D124G possibly damaging Het
Ppp3ca T G 3: 136,797,844 S59R probably benign Het
Rsu1 A G 2: 13,170,135 probably benign Het
Rttn T C 18: 89,015,246 probably benign Het
Ryr1 A T 7: 29,053,090 V3598E probably damaging Het
Sc5d G T 9: 42,255,570 N224K probably damaging Het
Tacc2 G A 7: 130,625,496 E1323K possibly damaging Het
Tbc1d21 T A 9: 58,363,069 D141V probably damaging Het
Trp53bp2 T C 1: 182,453,782 F983L probably damaging Het
Ubxn2a T A 12: 4,891,322 K95* probably null Het
Ugt3a2 G T 15: 9,365,288 W329L probably damaging Het
Unk T C 11: 116,050,123 Y237H probably benign Het
Vcam1 A C 3: 116,124,430 probably null Het
Xpo6 T C 7: 126,104,721 N1086D probably damaging Het
Zc3h12c A T 9: 52,144,056 L132Q possibly damaging Het
Other mutations in Nbeal2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Nbeal2 APN 9 110635869 missense probably damaging 1.00
IGL00784:Nbeal2 APN 9 110629763 splice site probably benign
IGL00826:Nbeal2 APN 9 110626903 missense probably benign
IGL00885:Nbeal2 APN 9 110638661 missense probably damaging 1.00
IGL01348:Nbeal2 APN 9 110629146 missense probably damaging 0.99
IGL01511:Nbeal2 APN 9 110629234 missense probably damaging 1.00
IGL01571:Nbeal2 APN 9 110632758 missense possibly damaging 0.63
IGL01612:Nbeal2 APN 9 110644678 missense probably damaging 1.00
IGL01924:Nbeal2 APN 9 110631414 missense probably benign 0.23
IGL02056:Nbeal2 APN 9 110627324 missense probably benign 0.17
IGL02481:Nbeal2 APN 9 110625995 nonsense probably null
IGL02483:Nbeal2 APN 9 110625995 nonsense probably null
IGL02502:Nbeal2 APN 9 110633768 missense probably damaging 1.00
IGL02631:Nbeal2 APN 9 110630208 missense probably damaging 0.99
IGL02637:Nbeal2 APN 9 110625977 missense possibly damaging 0.62
IGL02727:Nbeal2 APN 9 110639285 splice site probably benign
IGL02887:Nbeal2 APN 9 110628276 missense probably damaging 1.00
IGL02896:Nbeal2 APN 9 110639292 critical splice donor site probably null
IGL03110:Nbeal2 APN 9 110631433 missense probably damaging 1.00
legion UTSW 9 110629179 missense probably damaging 1.00
litigious UTSW 9 110628195 missense probably damaging 1.00
mall UTSW 9 110632886 missense probably damaging 1.00
Mollusca UTSW 9 110645438 intron probably null
schleuter UTSW 9 110628744 missense possibly damaging 0.69
shellfish UTSW 9 110628720 missense probably damaging 1.00
F5770:Nbeal2 UTSW 9 110637937 missense possibly damaging 0.65
R0032:Nbeal2 UTSW 9 110637868 splice site probably benign
R0084:Nbeal2 UTSW 9 110643710 critical splice donor site probably null
R0147:Nbeal2 UTSW 9 110642143 nonsense probably null
R0294:Nbeal2 UTSW 9 110632859 missense probably damaging 1.00
R0310:Nbeal2 UTSW 9 110638163 missense probably damaging 1.00
R0494:Nbeal2 UTSW 9 110627187 missense probably damaging 1.00
R0550:Nbeal2 UTSW 9 110642158 missense probably benign 0.01
R0630:Nbeal2 UTSW 9 110636034 splice site probably benign
R0762:Nbeal2 UTSW 9 110643808 splice site probably benign
R0862:Nbeal2 UTSW 9 110628195 missense probably damaging 1.00
R0864:Nbeal2 UTSW 9 110628195 missense probably damaging 1.00
R1225:Nbeal2 UTSW 9 110632886 missense probably damaging 1.00
R1240:Nbeal2 UTSW 9 110627108 missense probably damaging 0.98
R1450:Nbeal2 UTSW 9 110633672 splice site probably benign
R1519:Nbeal2 UTSW 9 110636305 missense probably damaging 1.00
R1655:Nbeal2 UTSW 9 110632872 missense probably damaging 1.00
R1668:Nbeal2 UTSW 9 110638893 missense probably damaging 1.00
R1705:Nbeal2 UTSW 9 110625196 missense probably damaging 1.00
R1784:Nbeal2 UTSW 9 110630857 nonsense probably null
R1834:Nbeal2 UTSW 9 110627129 missense probably damaging 1.00
R1997:Nbeal2 UTSW 9 110632198 missense probably damaging 1.00
R2013:Nbeal2 UTSW 9 110634071 missense probably benign 0.09
R2014:Nbeal2 UTSW 9 110634071 missense probably benign 0.09
R2055:Nbeal2 UTSW 9 110635307 missense possibly damaging 0.92
R2086:Nbeal2 UTSW 9 110634071 missense probably benign 0.09
R2113:Nbeal2 UTSW 9 110625406 missense probably damaging 1.00
R2167:Nbeal2 UTSW 9 110638308 missense probably damaging 1.00
R2201:Nbeal2 UTSW 9 110630250 missense probably benign 0.16
R2309:Nbeal2 UTSW 9 110626570 missense probably damaging 1.00
R2378:Nbeal2 UTSW 9 110630808 missense probably damaging 0.99
R2945:Nbeal2 UTSW 9 110628068 missense possibly damaging 0.82
R3076:Nbeal2 UTSW 9 110631700 missense probably damaging 1.00
R3176:Nbeal2 UTSW 9 110636887 splice site probably benign
R3974:Nbeal2 UTSW 9 110633846 missense probably damaging 1.00
R4183:Nbeal2 UTSW 9 110636675 missense probably benign
R4342:Nbeal2 UTSW 9 110631793 intron probably benign
R4654:Nbeal2 UTSW 9 110632004 missense probably damaging 1.00
R4707:Nbeal2 UTSW 9 110632055 missense probably benign 0.10
R4822:Nbeal2 UTSW 9 110636315 missense possibly damaging 0.82
R4854:Nbeal2 UTSW 9 110631396 missense probably damaging 1.00
R4860:Nbeal2 UTSW 9 110635194 missense probably benign 0.00
R4860:Nbeal2 UTSW 9 110635194 missense probably benign 0.00
R4990:Nbeal2 UTSW 9 110634803 missense probably benign 0.10
R4991:Nbeal2 UTSW 9 110638767 missense probably damaging 1.00
R5021:Nbeal2 UTSW 9 110637463 missense probably damaging 0.99
R5057:Nbeal2 UTSW 9 110631005 missense probably damaging 1.00
R5092:Nbeal2 UTSW 9 110626728 splice site probably null
R5161:Nbeal2 UTSW 9 110629868 missense probably benign
R5202:Nbeal2 UTSW 9 110644666 missense probably damaging 0.99
R5217:Nbeal2 UTSW 9 110632090 missense possibly damaging 0.56
R5408:Nbeal2 UTSW 9 110637520 missense possibly damaging 0.91
R5540:Nbeal2 UTSW 9 110631733 missense probably damaging 1.00
R5866:Nbeal2 UTSW 9 110631492 missense probably damaging 1.00
R5925:Nbeal2 UTSW 9 110629880 missense probably benign 0.00
R6057:Nbeal2 UTSW 9 110641877 missense possibly damaging 0.81
R6180:Nbeal2 UTSW 9 110625147 missense probably damaging 1.00
R6191:Nbeal2 UTSW 9 110627990 critical splice donor site probably null
R6232:Nbeal2 UTSW 9 110638734 missense probably damaging 1.00
R6372:Nbeal2 UTSW 9 110628744 missense possibly damaging 0.69
R6423:Nbeal2 UTSW 9 110625994 missense probably damaging 1.00
R6543:Nbeal2 UTSW 9 110644458 missense probably benign
R6648:Nbeal2 UTSW 9 110637642 missense probably damaging 1.00
R6722:Nbeal2 UTSW 9 110632992 missense probably damaging 1.00
R6738:Nbeal2 UTSW 9 110636905 missense possibly damaging 0.93
R6916:Nbeal2 UTSW 9 110626108 missense probably damaging 1.00
R6935:Nbeal2 UTSW 9 110639391 missense probably damaging 1.00
R7022:Nbeal2 UTSW 9 110638618 missense probably damaging 1.00
R7023:Nbeal2 UTSW 9 110638618 missense probably damaging 1.00
R7050:Nbeal2 UTSW 9 110628720 missense probably damaging 1.00
R7072:Nbeal2 UTSW 9 110626051 missense probably benign 0.01
R7073:Nbeal2 UTSW 9 110626109 missense probably damaging 0.99
R7099:Nbeal2 UTSW 9 110645438 intron probably null
R7354:Nbeal2 UTSW 9 110629179 missense probably damaging 1.00
R7394:Nbeal2 UTSW 9 110630189 critical splice donor site probably null
R7397:Nbeal2 UTSW 9 110628032 missense possibly damaging 0.78
R7552:Nbeal2 UTSW 9 110653917 missense probably benign 0.16
R7619:Nbeal2 UTSW 9 110625818 missense probably benign 0.19
R7821:Nbeal2 UTSW 9 110630252 missense probably damaging 1.00
R7902:Nbeal2 UTSW 9 110637547 missense probably benign
R7985:Nbeal2 UTSW 9 110637547 missense probably benign
V7583:Nbeal2 UTSW 9 110637937 missense possibly damaging 0.65
X0017:Nbeal2 UTSW 9 110644278 missense probably benign 0.02
X0065:Nbeal2 UTSW 9 110644413 splice site probably benign
Z1088:Nbeal2 UTSW 9 110632372 missense possibly damaging 0.51
Z1176:Nbeal2 UTSW 9 110625816 missense probably benign 0.01
Z1176:Nbeal2 UTSW 9 110638835 missense probably benign
Z1177:Nbeal2 UTSW 9 110629854 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGTACCGACCTTGCAATTTCC -3'
(R):5'- GCTGAAACCCTTAGGCCATTTTC -3'

Sequencing Primer
(F):5'- GACCTTGCAATTTCCTGGCTC -3'
(R):5'- TTCCTAAGGCCTTGGTGCCAG -3'
Posted On2015-02-05