Incidental Mutation 'R3052:Unk'
ID265001
Institutional Source Beutler Lab
Gene Symbol Unk
Ensembl Gene ENSMUSG00000020770
Gene Nameunkempt family zinc finger
SynonymsZc3h5, B230379M23Rik
MMRRC Submission 040561-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.742) question?
Stock #R3052 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location116030322-116061214 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116050123 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 237 (Y237H)
Ref Sequence ENSEMBL: ENSMUSP00000102060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021116] [ENSMUST00000106452]
Predicted Effect probably benign
Transcript: ENSMUST00000021116
AA Change: Y237H

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000021116
Gene: ENSMUSG00000020770
AA Change: Y237H

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 70 78 N/A INTRINSIC
ZnF_C3H1 85 112 1.03e-2 SMART
ZnF_C3H1 124 153 4.3e1 SMART
ZnF_C3H1 215 240 1.1e0 SMART
ZnF_C3H1 251 284 2.17e-1 SMART
ZnF_C3H1 293 320 1.38e-3 SMART
low complexity region 347 365 N/A INTRINSIC
low complexity region 467 489 N/A INTRINSIC
low complexity region 563 585 N/A INTRINSIC
coiled coil region 643 723 N/A INTRINSIC
RING 769 800 2.74e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106452
AA Change: Y237H

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000102060
Gene: ENSMUSG00000020770
AA Change: Y237H

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 70 78 N/A INTRINSIC
ZnF_C3H1 85 112 1.03e-2 SMART
ZnF_C3H1 124 153 4.3e1 SMART
ZnF_C3H1 215 240 1.1e0 SMART
ZnF_C3H1 251 284 2.17e-1 SMART
ZnF_C3H1 293 320 1.38e-3 SMART
low complexity region 454 476 N/A INTRINSIC
low complexity region 550 572 N/A INTRINSIC
coiled coil region 630 710 N/A INTRINSIC
RING 756 787 2.74e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150759
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176212
Meta Mutation Damage Score 0.1038 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 G A 8: 46,521,337 V330I probably benign Het
Adcy5 T C 16: 35,303,716 L1255P probably damaging Het
Ampd2 C T 3: 108,086,487 probably benign Het
Asb18 T A 1: 89,992,985 H149L probably damaging Het
Atp8b1 T C 18: 64,553,108 E668G probably benign Het
Axdnd1 T C 1: 156,341,870 T809A probably damaging Het
B430306N03Rik T C 17: 48,316,910 S80P probably damaging Het
Banp G A 8: 122,005,687 probably null Het
Capn2 G A 1: 182,487,772 T306M probably benign Het
Ccpg1 A T 9: 73,005,868 S229C probably damaging Het
Cep250 G T 2: 155,991,048 S1630I probably damaging Het
Ces1g C A 8: 93,335,048 V77L possibly damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col6a3 T A 1: 90,802,130 H1211L possibly damaging Het
Cyp2a5 A G 7: 26,842,985 I471V possibly damaging Het
Gm10384 A G 15: 36,871,752 noncoding transcript Het
Gm973 T C 1: 59,633,140 probably benign Het
Ift88 C T 14: 57,430,568 P9S probably damaging Het
Mfsd2a A G 4: 122,951,842 L172P probably damaging Het
Nav3 T A 10: 109,903,752 I119F probably damaging Het
Nbeal2 T C 9: 110,633,085 E1428G possibly damaging Het
Olfr1126 C A 2: 87,457,903 T246K probably damaging Het
Phf13 T C 4: 151,992,363 D124G possibly damaging Het
Ppp3ca T G 3: 136,797,844 S59R probably benign Het
Rsu1 A G 2: 13,170,135 probably benign Het
Rttn T C 18: 89,015,246 probably benign Het
Ryr1 A T 7: 29,053,090 V3598E probably damaging Het
Sc5d G T 9: 42,255,570 N224K probably damaging Het
Tacc2 G A 7: 130,625,496 E1323K possibly damaging Het
Tbc1d21 T A 9: 58,363,069 D141V probably damaging Het
Trp53bp2 T C 1: 182,453,782 F983L probably damaging Het
Ubxn2a T A 12: 4,891,322 K95* probably null Het
Ugt3a2 G T 15: 9,365,288 W329L probably damaging Het
Vcam1 A C 3: 116,124,430 probably null Het
Xpo6 T C 7: 126,104,721 N1086D probably damaging Het
Zc3h12c A T 9: 52,144,056 L132Q possibly damaging Het
Other mutations in Unk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01782:Unk APN 11 116058379 missense probably benign 0.44
IGL01956:Unk APN 11 116056334 missense probably damaging 1.00
IGL02044:Unk APN 11 116049328 missense probably damaging 0.99
IGL02738:Unk APN 11 116056191 missense probably damaging 1.00
IGL02861:Unk APN 11 116056299 missense possibly damaging 0.58
legal_midget UTSW 11 116050724 missense probably damaging 1.00
produce UTSW 11 116051459 missense probably damaging 1.00
R0098:Unk UTSW 11 116050169 missense probably damaging 1.00
R0098:Unk UTSW 11 116050169 missense probably damaging 1.00
R0827:Unk UTSW 11 116053109 missense possibly damaging 0.59
R1471:Unk UTSW 11 116049409 missense probably benign 0.45
R1824:Unk UTSW 11 116030442 unclassified probably benign
R1900:Unk UTSW 11 116059081 missense probably benign 0.01
R4033:Unk UTSW 11 116053527 missense probably benign 0.00
R4449:Unk UTSW 11 116053634 missense probably damaging 1.00
R4593:Unk UTSW 11 116049056 missense probably benign 0.02
R4847:Unk UTSW 11 116054406 missense probably damaging 1.00
R4921:Unk UTSW 11 116054945 missense probably benign
R4940:Unk UTSW 11 116053665 missense possibly damaging 0.63
R5099:Unk UTSW 11 116059110 missense probably benign 0.00
R5838:Unk UTSW 11 116049331 missense probably damaging 1.00
R6351:Unk UTSW 11 116054946 missense probably benign
R6387:Unk UTSW 11 116054940 missense possibly damaging 0.88
R6551:Unk UTSW 11 116050724 missense probably damaging 1.00
R6554:Unk UTSW 11 116051459 missense probably damaging 1.00
R6599:Unk UTSW 11 116047802 missense probably damaging 1.00
R6733:Unk UTSW 11 116050755 missense probably damaging 1.00
R7743:Unk UTSW 11 116049436 missense possibly damaging 0.74
R7765:Unk UTSW 11 116053082 missense probably benign 0.25
Z1176:Unk UTSW 11 116047764 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGACCTGTTAATACCTTGCATG -3'
(R):5'- TGAGCCCTGTAAACCCAGTG -3'

Sequencing Primer
(F):5'- AATACCTTGCATGGGATCTCAGC -3'
(R):5'- GTAAACCCAGTGGCTTAGATTCCTG -3'
Posted On2015-02-05