Incidental Mutation 'R3052:Ugt3a2'
ID265005
Institutional Source Beutler Lab
Gene Symbol Ugt3a2
Ensembl Gene ENSMUSG00000049152
Gene NameUDP glycosyltransferases 3 family, polypeptide A2
Synonyms
MMRRC Submission 040561-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R3052 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location9335550-9370955 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 9365288 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 329 (W329L)
Ref Sequence ENSEMBL: ENSMUSP00000072236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072403]
Predicted Effect probably damaging
Transcript: ENSMUST00000072403
AA Change: W329L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072236
Gene: ENSMUSG00000049152
AA Change: W329L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:UDPGT 23 521 1.1e-99 PFAM
Pfam:Glyco_tran_28_C 307 450 1.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144755
Meta Mutation Damage Score 0.9046 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 G A 8: 46,521,337 V330I probably benign Het
Adcy5 T C 16: 35,303,716 L1255P probably damaging Het
Ampd2 C T 3: 108,086,487 probably benign Het
Asb18 T A 1: 89,992,985 H149L probably damaging Het
Atp8b1 T C 18: 64,553,108 E668G probably benign Het
Axdnd1 T C 1: 156,341,870 T809A probably damaging Het
B430306N03Rik T C 17: 48,316,910 S80P probably damaging Het
Banp G A 8: 122,005,687 probably null Het
Capn2 G A 1: 182,487,772 T306M probably benign Het
Ccpg1 A T 9: 73,005,868 S229C probably damaging Het
Cep250 G T 2: 155,991,048 S1630I probably damaging Het
Ces1g C A 8: 93,335,048 V77L possibly damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col6a3 T A 1: 90,802,130 H1211L possibly damaging Het
Cyp2a5 A G 7: 26,842,985 I471V possibly damaging Het
Gm10384 A G 15: 36,871,752 noncoding transcript Het
Gm973 T C 1: 59,633,140 probably benign Het
Ift88 C T 14: 57,430,568 P9S probably damaging Het
Mfsd2a A G 4: 122,951,842 L172P probably damaging Het
Nav3 T A 10: 109,903,752 I119F probably damaging Het
Nbeal2 T C 9: 110,633,085 E1428G possibly damaging Het
Olfr1126 C A 2: 87,457,903 T246K probably damaging Het
Phf13 T C 4: 151,992,363 D124G possibly damaging Het
Ppp3ca T G 3: 136,797,844 S59R probably benign Het
Rsu1 A G 2: 13,170,135 probably benign Het
Rttn T C 18: 89,015,246 probably benign Het
Ryr1 A T 7: 29,053,090 V3598E probably damaging Het
Sc5d G T 9: 42,255,570 N224K probably damaging Het
Tacc2 G A 7: 130,625,496 E1323K possibly damaging Het
Tbc1d21 T A 9: 58,363,069 D141V probably damaging Het
Trp53bp2 T C 1: 182,453,782 F983L probably damaging Het
Ubxn2a T A 12: 4,891,322 K95* probably null Het
Unk T C 11: 116,050,123 Y237H probably benign Het
Vcam1 A C 3: 116,124,430 probably null Het
Xpo6 T C 7: 126,104,721 N1086D probably damaging Het
Zc3h12c A T 9: 52,144,056 L132Q possibly damaging Het
Other mutations in Ugt3a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Ugt3a2 APN 15 9367268 missense probably damaging 0.99
IGL01131:Ugt3a2 APN 15 9365162 missense probably damaging 1.00
IGL01627:Ugt3a2 APN 15 9335720 missense probably damaging 1.00
IGL01746:Ugt3a2 APN 15 9361668 missense probably damaging 1.00
IGL01949:Ugt3a2 APN 15 9335729 missense probably damaging 1.00
IGL02213:Ugt3a2 APN 15 9370224 missense probably benign 0.00
IGL02407:Ugt3a2 APN 15 9365230 nonsense probably null
IGL02588:Ugt3a2 APN 15 9361456 missense probably benign
IGL02894:Ugt3a2 APN 15 9367401 missense probably damaging 1.00
IGL02966:Ugt3a2 APN 15 9370068 missense probably damaging 1.00
IGL03385:Ugt3a2 APN 15 9338738 missense probably damaging 0.99
IGL03493:Ugt3a2 APN 15 9361483 missense probably damaging 0.96
R0554:Ugt3a2 UTSW 15 9351120 missense probably benign 0.14
R0833:Ugt3a2 UTSW 15 9370150 missense probably damaging 0.96
R1071:Ugt3a2 UTSW 15 9367368 missense possibly damaging 0.82
R1513:Ugt3a2 UTSW 15 9361524 missense probably benign 0.07
R1844:Ugt3a2 UTSW 15 9351168 missense probably benign 0.07
R1874:Ugt3a2 UTSW 15 9365351 missense probably damaging 1.00
R2305:Ugt3a2 UTSW 15 9351117 missense probably benign
R3755:Ugt3a2 UTSW 15 9367412 missense probably benign 0.21
R3945:Ugt3a2 UTSW 15 9370098 missense possibly damaging 0.91
R4135:Ugt3a2 UTSW 15 9338724 missense probably damaging 0.98
R4261:Ugt3a2 UTSW 15 9335793 splice site probably null
R4438:Ugt3a2 UTSW 15 9351197 missense probably benign 0.01
R4570:Ugt3a2 UTSW 15 9338721 missense probably benign 0.12
R4791:Ugt3a2 UTSW 15 9361579 missense probably damaging 1.00
R4957:Ugt3a2 UTSW 15 9365188 missense probably benign 0.27
R5011:Ugt3a2 UTSW 15 9365287 missense probably damaging 1.00
R5035:Ugt3a2 UTSW 15 9361618 missense probably benign 0.01
R5554:Ugt3a2 UTSW 15 9370201 missense probably damaging 1.00
R5573:Ugt3a2 UTSW 15 9361683 missense probably damaging 1.00
R5631:Ugt3a2 UTSW 15 9361885 missense probably damaging 0.98
R5696:Ugt3a2 UTSW 15 9361448 splice site silent
R6265:Ugt3a2 UTSW 15 9361579 missense probably damaging 1.00
R6302:Ugt3a2 UTSW 15 9365311 missense probably damaging 1.00
R6311:Ugt3a2 UTSW 15 9361518 nonsense probably null
R6680:Ugt3a2 UTSW 15 9370068 missense probably damaging 1.00
Z1177:Ugt3a2 UTSW 15 9367257 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ATTTATTTAACACCCAGCCTGC -3'
(R):5'- TCTGCCAGTCCAAGTGTTCAG -3'

Sequencing Primer
(F):5'- ATGCTGCTTTGGCCTTTACAAAC -3'
(R):5'- AGTCCAAGTGTTCAGACATCAG -3'
Posted On2015-02-05