Mutagenetix > Incidental Mutations

Incidental Mutation 'R3052:Atp8b1'

265011

Institutional Source

Beutler Lab

Gene Symbol

Atp8b1

Ensembl Gene

ENSMUSG00000039529

Gene Name

ATPase, class I, type 8B, member 1

Synonyms

FIC1, Ic

MMRRC Submission

040561-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3052 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

64528979-64661000 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 64553108 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 668 (E668G)

Ref Sequence

ENSEMBL: ENSMUSP00000025482 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025482]

Predicted Effect

probably benign
Transcript: ENSMUST00000025482
AA Change: E668G

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000025482
Gene: ENSMUSG00000039529
AA Change: E668G

Domain	Start	End	E-Value	Type
Pfam:PhoLip_ATPase_N	65	144	5.3e-29	PFAM
Pfam:E1-E2_ATPase	146	413	6e-11	PFAM
Pfam:HAD	451	902	2.4e-21	PFAM
Pfam:Cation_ATPase	532	632	1e-12	PFAM
Pfam:PhoLip_ATPase_C	919	1173	7.3e-82	PFAM
low complexity region	1193	1207	N/A	INTRINSIC
low complexity region	1221	1232	N/A	INTRINSIC

Meta Mutation Damage Score

0.1505

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 93.8%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the P-type cation transport ATPase family, which belongs to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. Mutations in this gene may result in progressive familial intrahepatic cholestasis type 1 and in benign recurrent intrahepatic cholestasis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice display abnormal bile salt homeostasis, normal bile secretion, and an impaired ability to handle increased bile salt loading resulting in liver damage and weight loss on a bile salt supplemented diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsl1	G	A	8: 46,521,337	V330I	probably benign	Het
Adcy5	T	C	16: 35,303,716	L1255P	probably damaging	Het
Ampd2	C	T	3: 108,086,487		probably benign	Het
Asb18	T	A	1: 89,992,985	H149L	probably damaging	Het
Axdnd1	T	C	1: 156,341,870	T809A	probably damaging	Het
B430306N03Rik	T	C	17: 48,316,910	S80P	probably damaging	Het
Banp	G	A	8: 122,005,687		probably null	Het
Capn2	G	A	1: 182,487,772	T306M	probably benign	Het
Ccpg1	A	T	9: 73,005,868	S229C	probably damaging	Het
Cep250	G	T	2: 155,991,048	S1630I	probably damaging	Het
Ces1g	C	A	8: 93,335,048	V77L	possibly damaging	Het
Cldn8	A	C	16: 88,562,731	M102R	probably damaging	Het
Col6a3	T	A	1: 90,802,130	H1211L	possibly damaging	Het
Cyp2a5	A	G	7: 26,842,985	I471V	possibly damaging	Het
Gm10384	A	G	15: 36,871,752		noncoding transcript	Het
Gm973	T	C	1: 59,633,140		probably benign	Het
Ift88	C	T	14: 57,430,568	P9S	probably damaging	Het
Mfsd2a	A	G	4: 122,951,842	L172P	probably damaging	Het
Nav3	T	A	10: 109,903,752	I119F	probably damaging	Het
Nbeal2	T	C	9: 110,633,085	E1428G	possibly damaging	Het
Olfr1126	C	A	2: 87,457,903	T246K	probably damaging	Het
Phf13	T	C	4: 151,992,363	D124G	possibly damaging	Het
Ppp3ca	T	G	3: 136,797,844	S59R	probably benign	Het
Rsu1	A	G	2: 13,170,135		probably benign	Het
Rttn	T	C	18: 89,015,246		probably benign	Het
Ryr1	A	T	7: 29,053,090	V3598E	probably damaging	Het
Sc5d	G	T	9: 42,255,570	N224K	probably damaging	Het
Tacc2	G	A	7: 130,625,496	E1323K	possibly damaging	Het
Tbc1d21	T	A	9: 58,363,069	D141V	probably damaging	Het
Trp53bp2	T	C	1: 182,453,782	F983L	probably damaging	Het
Ubxn2a	T	A	12: 4,891,322	K95*	probably null	Het
Ugt3a2	G	T	15: 9,365,288	W329L	probably damaging	Het
Unk	T	C	11: 116,050,123	Y237H	probably benign	Het
Vcam1	A	C	3: 116,124,430		probably null	Het
Xpo6	T	C	7: 126,104,721	N1086D	probably damaging	Het
Zc3h12c	A	T	9: 52,144,056	L132Q	possibly damaging	Het

Other mutations in Atp8b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00472:Atp8b1	APN	18	64564430	missense	probably benign	0.23
IGL00907:Atp8b1	APN	18	64561705	missense	possibly damaging	0.95
IGL00962:Atp8b1	APN	18	64531444	missense	probably damaging	1.00
IGL01433:Atp8b1	APN	18	64573519	missense	probably benign	0.00
IGL01525:Atp8b1	APN	18	64539252	nonsense	probably null
IGL01645:Atp8b1	APN	18	64546113	missense	probably benign	0.06
IGL02008:Atp8b1	APN	18	64538695	splice site	probably benign
IGL02227:Atp8b1	APN	18	64562190	missense	probably benign
IGL02231:Atp8b1	APN	18	64550384	missense	possibly damaging	0.94
IGL02326:Atp8b1	APN	18	64538583	missense	probably damaging	0.99
IGL02562:Atp8b1	APN	18	64581986	missense	probably benign
IGL02929:Atp8b1	APN	18	64561662	missense	possibly damaging	0.63
enchilada	UTSW	18	64545989	critical splice donor site	probably null
PIT4520001:Atp8b1	UTSW	18	64568180	missense	probably benign	0.34
PIT4696001:Atp8b1	UTSW	18	64539270	missense	possibly damaging	0.93
R0144:Atp8b1	UTSW	18	64571374	splice site	probably benign
R0193:Atp8b1	UTSW	18	64561636	missense	probably benign
R0277:Atp8b1	UTSW	18	64568252	missense	possibly damaging	0.94
R0308:Atp8b1	UTSW	18	64545244	nonsense	probably null
R0323:Atp8b1	UTSW	18	64568252	missense	possibly damaging	0.94
R0403:Atp8b1	UTSW	18	64540310	missense	probably damaging	1.00
R0601:Atp8b1	UTSW	18	64571653	splice site	probably null
R0614:Atp8b1	UTSW	18	64533587	splice site	probably benign
R0883:Atp8b1	UTSW	18	64564541	missense	probably benign	0.44
R1077:Atp8b1	UTSW	18	64573262	nonsense	probably null
R1292:Atp8b1	UTSW	18	64571021	missense	probably damaging	0.99
R1494:Atp8b1	UTSW	18	64564526	missense	probably damaging	1.00
R1522:Atp8b1	UTSW	18	64550432	missense	probably benign	0.00
R1534:Atp8b1	UTSW	18	64545264	missense	probably damaging	1.00
R1535:Atp8b1	UTSW	18	64545264	missense	probably damaging	1.00
R1536:Atp8b1	UTSW	18	64545264	missense	probably damaging	1.00
R1537:Atp8b1	UTSW	18	64545264	missense	probably damaging	1.00
R1650:Atp8b1	UTSW	18	64571549	splice site	probably benign
R1772:Atp8b1	UTSW	18	64573492	missense	possibly damaging	0.88
R2016:Atp8b1	UTSW	18	64540334	missense	probably damaging	1.00
R2017:Atp8b1	UTSW	18	64540334	missense	probably damaging	1.00
R2043:Atp8b1	UTSW	18	64605200	missense	possibly damaging	0.94
R2223:Atp8b1	UTSW	18	64564357	missense	possibly damaging	0.88
R3694:Atp8b1	UTSW	18	64533721	missense	possibly damaging	0.81
R3738:Atp8b1	UTSW	18	64533729	splice site	probably benign
R4211:Atp8b1	UTSW	18	64553047	missense	probably damaging	1.00
R4362:Atp8b1	UTSW	18	64564537	missense	probably damaging	1.00
R4560:Atp8b1	UTSW	18	64556879	nonsense	probably null
R4560:Atp8b1	UTSW	18	64568247	missense	probably benign	0.11
R4562:Atp8b1	UTSW	18	64556891	missense	probably damaging	1.00
R4615:Atp8b1	UTSW	18	64553099	missense	probably null
R4676:Atp8b1	UTSW	18	64538678	missense	probably benign	0.01
R4738:Atp8b1	UTSW	18	64545180	missense	probably benign	0.31
R4774:Atp8b1	UTSW	18	64533659	missense	possibly damaging	0.49
R4808:Atp8b1	UTSW	18	64561711	missense	probably benign	0.01
R4868:Atp8b1	UTSW	18	64551866	missense	probably damaging	1.00
R5162:Atp8b1	UTSW	18	64561662	missense	possibly damaging	0.63
R5289:Atp8b1	UTSW	18	64546087	missense	possibly damaging	0.51
R5328:Atp8b1	UTSW	18	64531391	missense	probably benign	0.00
R5400:Atp8b1	UTSW	18	64545989	critical splice donor site	probably null
R5587:Atp8b1	UTSW	18	64539210	missense	probably damaging	1.00
R5623:Atp8b1	UTSW	18	64546094	missense	possibly damaging	0.85
R5651:Atp8b1	UTSW	18	64531382	missense	probably benign	0.31
R5652:Atp8b1	UTSW	18	64531382	missense	probably benign	0.31
R5653:Atp8b1	UTSW	18	64545197	missense	probably damaging	1.00
R5667:Atp8b1	UTSW	18	64581923	missense	probably damaging	1.00
R5689:Atp8b1	UTSW	18	64564537	missense	probably damaging	1.00
R6008:Atp8b1	UTSW	18	64577616	missense	probably damaging	1.00
R6315:Atp8b1	UTSW	18	64531479	missense	probably damaging	0.97
R6759:Atp8b1	UTSW	18	64546090	missense	probably benign	0.00
R6850:Atp8b1	UTSW	18	64556852	missense	possibly damaging	0.94
R7255:Atp8b1	UTSW	18	64556868	missense	probably damaging	1.00
R7606:Atp8b1	UTSW	18	64555115	missense	probably damaging	1.00
R7635:Atp8b1	UTSW	18	64573305	missense	possibly damaging	0.59
R7639:Atp8b1	UTSW	18	64564543	missense	possibly damaging	0.91
R7698:Atp8b1	UTSW	18	64571022	missense	probably benign	0.03
R7727:Atp8b1	UTSW	18	64545275	missense	probably damaging	1.00
R7779:Atp8b1	UTSW	18	64541382	missense	probably damaging	1.00
R7785:Atp8b1	UTSW	18	64556850	missense	probably damaging	1.00
X0025:Atp8b1	UTSW	18	64571405	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CGTGACATCAGAGATGCAATG -3'
(R):5'- GACTCTATGGGATGGCTCAAC -3'

Sequencing Primer
(F):5'- CGTGACATCAGAGATGCAATGAATCG -3'
(R):5'- TGATGAGACCCACATATGTGCCATG -3'

Posted On

2015-02-05