Mutagenetix > Incidental Mutations

Incidental Mutation 'R3052:Rttn'

265012

Institutional Source

Beutler Lab

Gene Symbol

Rttn

Ensembl Gene

ENSMUSG00000023066

Gene Name

rotatin

Synonyms

C530033I08Rik, 4921538A15Rik

MMRRC Submission

040561-MU

Accession Numbers

Ncbi RefSeq: NM_175542.3; MGI:2179288

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3052 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

88971790-89131013 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 89015246 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000023828 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023828]

Predicted Effect

probably benign
Transcript: ENSMUST00000023828

SMART Domains

Protein: ENSMUSP00000023828
Gene: ENSMUSG00000023066

Domain	Start	End	E-Value	Type
Pfam:RTTN_N	16	112	1.2e-36	PFAM
low complexity region	188	199	N/A	INTRINSIC
Blast:ARM	216	261	9e-18	BLAST
low complexity region	302	319	N/A	INTRINSIC
low complexity region	335	341	N/A	INTRINSIC
SCOP:d1gw5a_	515	952	9e-3	SMART
Blast:ARM	863	910	4e-8	BLAST
low complexity region	972	985	N/A	INTRINSIC
low complexity region	1165	1176	N/A	INTRINSIC
low complexity region	1213	1222	N/A	INTRINSIC
low complexity region	1680	1698	N/A	INTRINSIC
low complexity region	1861	1879	N/A	INTRINSIC
Blast:ARM	2088	2129	1e-10	BLAST

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 93.8%

Validation Efficiency

100% (38/38)

MGI Phenotype

Strain: 2674124
Lethality: E9-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein whose specific function is unknown. Absence of the orthologous protein in mouse results in embryonic lethality with deficient axial rotation, abnormal differentiation of the neural tube, and randomized looping of the heart tube during development. In human, mutations in this gene are associated with polymicrogyria with seizures. In human fibroblasts this protein localizes at the ciliary basal bodies. Given the intracellular localization of this protein and the phenotypic effects of mutations, this gene is suspected of playing a role in the maintenance of normal ciliary structure which in turn effects the developmental process of left-right organ specification, axial rotation, and perhaps notochord development. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for an insertional mutation exhibit embryonic lethality and neurulation defects resulting in the arrest of gastrulation movements and abnormal left-right specification in the heart. [provided by MGI curators]

Allele List at MGI

All alleles(15) : Targeted(2) Gene trapped(12) Transgenic(1)

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsl1	G	A	8: 46,521,337	V330I	probably benign	Het
Adcy5	T	C	16: 35,303,716	L1255P	probably damaging	Het
Ampd2	C	T	3: 108,086,487		probably benign	Het
Asb18	T	A	1: 89,992,985	H149L	probably damaging	Het
Atp8b1	T	C	18: 64,553,108	E668G	probably benign	Het
Axdnd1	T	C	1: 156,341,870	T809A	probably damaging	Het
B430306N03Rik	T	C	17: 48,316,910	S80P	probably damaging	Het
Banp	G	A	8: 122,005,687		probably null	Het
Capn2	G	A	1: 182,487,772	T306M	probably benign	Het
Ccpg1	A	T	9: 73,005,868	S229C	probably damaging	Het
Cep250	G	T	2: 155,991,048	S1630I	probably damaging	Het
Ces1g	C	A	8: 93,335,048	V77L	possibly damaging	Het
Cldn8	A	C	16: 88,562,731	M102R	probably damaging	Het
Col6a3	T	A	1: 90,802,130	H1211L	possibly damaging	Het
Cyp2a5	A	G	7: 26,842,985	I471V	possibly damaging	Het
Gm10384	A	G	15: 36,871,752		noncoding transcript	Het
Gm973	T	C	1: 59,633,140		probably benign	Het
Ift88	C	T	14: 57,430,568	P9S	probably damaging	Het
Mfsd2a	A	G	4: 122,951,842	L172P	probably damaging	Het
Nav3	T	A	10: 109,903,752	I119F	probably damaging	Het
Nbeal2	T	C	9: 110,633,085	E1428G	possibly damaging	Het
Olfr1126	C	A	2: 87,457,903	T246K	probably damaging	Het
Phf13	T	C	4: 151,992,363	D124G	possibly damaging	Het
Ppp3ca	T	G	3: 136,797,844	S59R	probably benign	Het
Rsu1	A	G	2: 13,170,135		probably benign	Het
Ryr1	A	T	7: 29,053,090	V3598E	probably damaging	Het
Sc5d	G	T	9: 42,255,570	N224K	probably damaging	Het
Tacc2	G	A	7: 130,625,496	E1323K	possibly damaging	Het
Tbc1d21	T	A	9: 58,363,069	D141V	probably damaging	Het
Trp53bp2	T	C	1: 182,453,782	F983L	probably damaging	Het
Ubxn2a	T	A	12: 4,891,322	K95*	probably null	Het
Ugt3a2	G	T	15: 9,365,288	W329L	probably damaging	Het
Unk	T	C	11: 116,050,123	Y237H	probably benign	Het
Vcam1	A	C	3: 116,124,430		probably null	Het
Xpo6	T	C	7: 126,104,721	N1086D	probably damaging	Het
Zc3h12c	A	T	9: 52,144,056	L132Q	possibly damaging	Het

Other mutations in Rttn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00595:Rttn	APN	18	88974340	missense	probably benign	0.00
IGL00788:Rttn	APN	18	88972509	missense	probably benign	0.00
IGL00929:Rttn	APN	18	89028935	missense	probably damaging	1.00
IGL01392:Rttn	APN	18	88995613	missense	probably benign	0.03
IGL01395:Rttn	APN	18	89129770	missense	possibly damaging	0.89
IGL01701:Rttn	APN	18	89064215	missense	probably damaging	1.00
IGL02136:Rttn	APN	18	89046128	missense	possibly damaging	0.87
IGL02151:Rttn	APN	18	89020205	missense	probably damaging	1.00
IGL02165:Rttn	APN	18	89043041	missense	probably benign
IGL02228:Rttn	APN	18	89042231	missense	probably damaging	1.00
IGL02276:Rttn	APN	18	89048454	missense	possibly damaging	0.94
IGL02612:Rttn	APN	18	88973626	missense	probably damaging	1.00
IGL02645:Rttn	APN	18	89110686	missense	probably benign	0.04
IGL02716:Rttn	APN	18	89048417	missense	possibly damaging	0.77
IGL02820:Rttn	APN	18	89028998	missense	probably damaging	1.00
IGL02961:Rttn	APN	18	89053573	missense	probably damaging	1.00
IGL02973:Rttn	APN	18	88972494	missense	probably damaging	1.00
IGL03027:Rttn	APN	18	88979690	missense	probably damaging	1.00
IGL03082:Rttn	APN	18	88983948	missense	probably damaging	1.00
IGL03121:Rttn	APN	18	88975751	missense	probably damaging	1.00
IGL03135:Rttn	APN	18	89015150	missense	probably damaging	1.00
IGL03328:Rttn	APN	18	89043028	missense	probably benign	0.19
R0062:Rttn	UTSW	18	89010966	critical splice donor site	probably null
R0062:Rttn	UTSW	18	89010966	critical splice donor site	probably null
R0310:Rttn	UTSW	18	89009460	splice site	probably benign
R0330:Rttn	UTSW	18	88986080	splice site	probably null
R0363:Rttn	UTSW	18	89010955	missense	probably damaging	1.00
R0485:Rttn	UTSW	18	89090419	splice site	probably benign
R0590:Rttn	UTSW	18	88979635	missense	probably damaging	1.00
R0601:Rttn	UTSW	18	89042966	missense	probably benign	0.00
R0604:Rttn	UTSW	18	88977758	missense	probably damaging	1.00
R0631:Rttn	UTSW	18	88989546	missense	probably benign	0.00
R0882:Rttn	UTSW	18	88973689	nonsense	probably null
R0885:Rttn	UTSW	18	88983810	missense	probably benign	0.03
R0900:Rttn	UTSW	18	89101691	missense	probably benign	0.13
R1077:Rttn	UTSW	18	89064249	missense	probably damaging	1.00
R1444:Rttn	UTSW	18	89042867	missense	probably benign	0.04
R1460:Rttn	UTSW	18	89109357	splice site	probably benign
R1517:Rttn	UTSW	18	89113350	missense	probably benign	0.01
R1630:Rttn	UTSW	18	89042954	missense	probably benign	0.02
R1632:Rttn	UTSW	18	89009336	missense	probably benign	0.18
R1722:Rttn	UTSW	18	88973531	missense	probably benign	0.34
R1755:Rttn	UTSW	18	89009317	missense	probably damaging	1.00
R1881:Rttn	UTSW	18	89015212	missense	probably damaging	0.96
R1971:Rttn	UTSW	18	89090433	missense	probably benign
R2035:Rttn	UTSW	18	89020216	missense	probably damaging	1.00
R2109:Rttn	UTSW	18	88986073	missense	possibly damaging	0.93
R2191:Rttn	UTSW	18	89095648	critical splice donor site	probably null
R2201:Rttn	UTSW	18	89010943	missense	possibly damaging	0.88
R2266:Rttn	UTSW	18	89064171	missense	probably benign	0.05
R3014:Rttn	UTSW	18	89014620	missense	probably damaging	1.00
R3427:Rttn	UTSW	18	89095651	splice site	probably null
R3431:Rttn	UTSW	18	89095571	missense	probably benign	0.04
R3786:Rttn	UTSW	18	89037894	missense	probably benign	0.00
R3803:Rttn	UTSW	18	88977707	missense	probably damaging	0.96
R3980:Rttn	UTSW	18	89017275	missense	probably benign	0.12
R4035:Rttn	UTSW	18	88995653	missense	probably benign	0.03
R4170:Rttn	UTSW	18	88975723	missense	probably damaging	1.00
R4223:Rttn	UTSW	18	89095584	missense	probably damaging	1.00
R4273:Rttn	UTSW	18	89091896	missense	probably benign
R4517:Rttn	UTSW	18	89028973	missense	probably damaging	0.99
R4674:Rttn	UTSW	18	89011011	intron	probably null
R4837:Rttn	UTSW	18	89090415	splice site	probably null
R4869:Rttn	UTSW	18	89043014	nonsense	probably null
R4881:Rttn	UTSW	18	89101685	missense	probably damaging	1.00
R4959:Rttn	UTSW	18	89042168	missense	probably damaging	1.00
R4973:Rttn	UTSW	18	89042168	missense	probably damaging	1.00
R4975:Rttn	UTSW	18	89064085	intron	probably null
R5166:Rttn	UTSW	18	89013094	missense	possibly damaging	0.48
R5243:Rttn	UTSW	18	89108063	missense	possibly damaging	0.74
R5594:Rttn	UTSW	18	89090436	missense	possibly damaging	0.95
R5654:Rttn	UTSW	18	89048432	missense	probably benign
R5794:Rttn	UTSW	18	88995569	missense	probably benign	0.18
R5799:Rttn	UTSW	18	89037946	missense	probably damaging	0.99
R5955:Rttn	UTSW	18	89121009	missense	probably damaging	0.99
R5963:Rttn	UTSW	18	89073695	missense	probably benign	0.01
R5989:Rttn	UTSW	18	88973626	missense	probably damaging	1.00
R6004:Rttn	UTSW	18	89021692	missense	probably damaging	0.96
R6132:Rttn	UTSW	18	89115646	critical splice donor site	probably null
R6430:Rttn	UTSW	18	89021685	missense	probably null	0.18
R6436:Rttn	UTSW	18	89110729	missense	probably damaging	1.00
R6681:Rttn	UTSW	18	89014611	missense	probably damaging	1.00
R6994:Rttn	UTSW	18	89028899	missense	probably damaging	1.00
R7049:Rttn	UTSW	18	89064216	missense	probably damaging	1.00
R7078:Rttn	UTSW	18	89009422	missense	probably benign	0.03
R7083:Rttn	UTSW	18	89090598	missense	probably damaging	1.00
R7250:Rttn	UTSW	18	88989523	missense	probably benign	0.03
R7402:Rttn	UTSW	18	88985911	missense	possibly damaging	0.92
R7565:Rttn	UTSW	18	89060479	missense	probably damaging	1.00
R7588:Rttn	UTSW	18	89064229	missense	probably damaging	0.97
X0017:Rttn	UTSW	18	89113402	missense	probably benign	0.01
X0022:Rttn	UTSW	18	88973667	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TTATAAACAGGTCTGTGAGGGG -3'
(R):5'- CGCTATGTAAAGCATACACAGG -3'

Sequencing Primer
(F):5'- GGGACCTGGTGGGACATC -3'
(R):5'- AGGCAAATTCGCTATCCCTG -3'

Posted On

2015-02-05