Incidental Mutation 'R3053:Axdnd1'
ID 265018
Institutional Source Beutler Lab
Gene Symbol Axdnd1
Ensembl Gene ENSMUSG00000026601
Gene Name axonemal dynein light chain domain containing 1
Synonyms LOC381304, 9430070O13Rik
MMRRC Submission 040562-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock # R3053 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 156323509-156421159 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 156341870 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 809 (T809A)
Ref Sequence ENSEMBL: ENSMUSP00000148420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177824] [ENSMUST00000178036] [ENSMUST00000212747] [ENSMUST00000213088]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000177824
SMART Domains Protein: ENSMUSP00000135900
Gene: ENSMUSG00000026601

DomainStartEndE-ValueType
Pfam:Ax_dynein_light 131 314 2.4e-12 PFAM
low complexity region 405 414 N/A INTRINSIC
low complexity region 452 464 N/A INTRINSIC
low complexity region 666 677 N/A INTRINSIC
coiled coil region 787 837 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000178036
AA Change: T809A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000137354
Gene: ENSMUSG00000026601
AA Change: T809A

DomainStartEndE-ValueType
Pfam:Ax_dynein_light 196 380 3.3e-14 PFAM
low complexity region 470 479 N/A INTRINSIC
low complexity region 517 529 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
coiled coil region 889 939 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212342
Predicted Effect probably benign
Transcript: ENSMUST00000212747
Predicted Effect probably damaging
Transcript: ENSMUST00000213088
AA Change: T809A

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.1133 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 T C 16: 35,303,716 L1255P probably damaging Het
Agl T A 3: 116,791,033 I213F probably damaging Het
Arap2 A G 5: 62,748,857 V273A probably benign Het
Asb18 T A 1: 89,992,985 H149L probably damaging Het
Bcl11b T C 12: 107,916,001 E613G probably benign Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cyp2a5 A G 7: 26,842,985 I471V possibly damaging Het
Dmtf1 G T 5: 9,129,316 T206K probably damaging Het
Dner G T 1: 84,384,026 Q621K probably damaging Het
Fam92a G C 4: 12,157,767 probably null Het
Gmppa A G 1: 75,441,756 Y261C probably benign Het
Lama5 C T 2: 180,183,067 R2519K probably damaging Het
Mical2 G T 7: 112,311,423 A267S probably damaging Het
Nrxn3 A T 12: 89,255,101 D550V probably damaging Het
Olfr351 T A 2: 36,859,947 M134L probably benign Het
Pole A T 5: 110,289,795 D73V probably damaging Het
Ppm1b G A 17: 85,013,846 R472K probably benign Het
Ppm1m A G 9: 106,198,675 I18T probably benign Het
Psg18 C T 7: 18,349,193 G225R probably damaging Het
R3hcc1l T G 19: 42,562,625 Y20* probably null Het
Rapgef1 T C 2: 29,724,856 I817T probably damaging Het
Rasal3 T C 17: 32,403,439 E4G probably benign Het
Ryr1 A T 7: 29,053,090 V3598E probably damaging Het
Slc15a4 A T 5: 127,596,682 V556E possibly damaging Het
Spats2l A G 1: 57,900,766 K193R probably damaging Het
Tacc2 G A 7: 130,625,496 E1323K possibly damaging Het
Tbc1d21 T A 9: 58,363,069 D141V probably damaging Het
Tedc1 G T 12: 113,156,467 probably benign Het
Terf2 A C 8: 107,079,384 L312R possibly damaging Het
Tmem132d A C 5: 127,792,474 S599A probably benign Het
Trp53bp2 T C 1: 182,453,782 F983L probably damaging Het
Ubxn2a T A 12: 4,891,322 K95* probably null Het
Ugt2a2 A T 5: 87,474,469 N213K probably damaging Het
Xpo6 T C 7: 126,104,721 N1086D probably damaging Het
Zbed5 A T 5: 129,902,146 H312L possibly damaging Het
Zfp729b A G 13: 67,593,466 Y227H probably damaging Het
Other mutations in Axdnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03058:Axdnd1 APN 1 156376663 missense probably benign 0.41
IGL03075:Axdnd1 APN 1 156395442 missense probably damaging 1.00
IGL03165:Axdnd1 APN 1 156378389 missense probably benign 0.00
R0164:Axdnd1 UTSW 1 156378386 missense possibly damaging 0.93
R0164:Axdnd1 UTSW 1 156378386 missense possibly damaging 0.93
R0739:Axdnd1 UTSW 1 156380886 missense possibly damaging 0.73
R1087:Axdnd1 UTSW 1 156365689 missense probably benign 0.08
R1350:Axdnd1 UTSW 1 156378380 critical splice donor site probably null
R1488:Axdnd1 UTSW 1 156348960 missense probably damaging 1.00
R1493:Axdnd1 UTSW 1 156346701 missense probably benign 0.03
R1845:Axdnd1 UTSW 1 156376544 missense possibly damaging 0.58
R1900:Axdnd1 UTSW 1 156380774 splice site probably null
R2126:Axdnd1 UTSW 1 156333214 missense probably benign 0.03
R2163:Axdnd1 UTSW 1 156392003 missense probably damaging 1.00
R2169:Axdnd1 UTSW 1 156418309 missense probably damaging 1.00
R2380:Axdnd1 UTSW 1 156365651 missense probably benign 0.02
R2568:Axdnd1 UTSW 1 156392749 missense possibly damaging 0.90
R3052:Axdnd1 UTSW 1 156341870 missense probably damaging 0.96
R3767:Axdnd1 UTSW 1 156380858 missense probably damaging 1.00
R3927:Axdnd1 UTSW 1 156419270 missense probably damaging 1.00
R3936:Axdnd1 UTSW 1 156331639 missense probably benign 0.01
R4829:Axdnd1 UTSW 1 156376646 missense possibly damaging 0.93
R4882:Axdnd1 UTSW 1 156395559 splice site probably null
R4969:Axdnd1 UTSW 1 156395505 missense possibly damaging 0.95
R5091:Axdnd1 UTSW 1 156420410 missense possibly damaging 0.83
R5510:Axdnd1 UTSW 1 156335350 missense probably benign 0.03
R5549:Axdnd1 UTSW 1 156398534 missense probably damaging 1.00
R5587:Axdnd1 UTSW 1 156351412 missense probably damaging 1.00
R5792:Axdnd1 UTSW 1 156341889 missense probably damaging 0.99
R5840:Axdnd1 UTSW 1 156348958 missense probably damaging 1.00
R6187:Axdnd1 UTSW 1 156365612 splice site probably null
R6208:Axdnd1 UTSW 1 156392856 intron probably benign
R6369:Axdnd1 UTSW 1 156392745 missense probably damaging 1.00
R6493:Axdnd1 UTSW 1 156380813 missense probably damaging 1.00
R7014:Axdnd1 UTSW 1 156330962 splice site probably null
R7115:Axdnd1 UTSW 1 156380876 missense
R7203:Axdnd1 UTSW 1 156382389 missense probably damaging 0.98
R7352:Axdnd1 UTSW 1 156382477 missense possibly damaging 0.91
R7447:Axdnd1 UTSW 1 156418232 critical splice donor site probably null
R7470:Axdnd1 UTSW 1 156376516 missense
R7686:Axdnd1 UTSW 1 156395464 nonsense probably null
R7793:Axdnd1 UTSW 1 156338743 critical splice donor site probably null
R7809:Axdnd1 UTSW 1 156392801 nonsense probably null
R7882:Axdnd1 UTSW 1 156397453 missense
R8256:Axdnd1 UTSW 1 156330666 missense unknown
R8348:Axdnd1 UTSW 1 156418284 missense probably benign 0.02
R8971:Axdnd1 UTSW 1 156391946 missense
R9207:Axdnd1 UTSW 1 156388046 missense
R9294:Axdnd1 UTSW 1 156420347 nonsense probably null
R9741:Axdnd1 UTSW 1 156341815 missense probably benign 0.18
X0009:Axdnd1 UTSW 1 156388079 missense possibly damaging 0.61
X0067:Axdnd1 UTSW 1 156376535 missense possibly damaging 0.67
Z1176:Axdnd1 UTSW 1 156349063 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGGTGAGCATGTAGAACAGC -3'
(R):5'- CAGTGAGACACTTCTGTGCAG -3'

Sequencing Primer
(F):5'- CTGCAACTTAGGTACCCTGAGATG -3'
(R):5'- ACTTCTGTGCAGGTCTTTGAAC -3'
Posted On 2015-02-05