Incidental Mutation 'I1329:Tph1'
ID26502
Institutional Source Beutler Lab
Gene Symbol Tph1
Ensembl Gene ENSMUSG00000040046
Gene Nametryptophan hydroxylase 1
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #I1329 (G1) of strain toku
Quality Score222
Status Validated (trace)
Chromosome7
Chromosomal Location46644641-46672537 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46650013 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 368 (L368P)
Ref Sequence ENSEMBL: ENSMUSP00000103296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049298] [ENSMUST00000107669] [ENSMUST00000170251]
Predicted Effect probably damaging
Transcript: ENSMUST00000049298
AA Change: L368P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037752
Gene: ENSMUSG00000040046
AA Change: L368P

DomainStartEndE-ValueType
Pfam:ACT 21 87 4.3e-8 PFAM
Pfam:Biopterin_H 109 440 4.7e-188 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107669
AA Change: L368P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103296
Gene: ENSMUSG00000040046
AA Change: L368P

DomainStartEndE-ValueType
Pfam:Biopterin_H 109 439 7.6e-176 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000110264
Predicted Effect probably benign
Transcript: ENSMUST00000170251
SMART Domains Protein: ENSMUSP00000132489
Gene: ENSMUSG00000040046

DomainStartEndE-ValueType
Pfam:ACT 21 87 6.7e-8 PFAM
Pfam:Biopterin_H 109 279 3e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172386
SMART Domains Protein: ENSMUSP00000128727
Gene: ENSMUSG00000040046

DomainStartEndE-ValueType
Pfam:ACT 17 82 6.9e-9 PFAM
Pfam:Biopterin_H 105 164 8.9e-24 PFAM
low complexity region 175 188 N/A INTRINSIC
Meta Mutation Damage Score 0.2398 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 95.2%
Validation Efficiency 89% (42/47)
MGI Phenotype FUNCTION: This gene encodes a member of the biopterin-dependent aromatic amino acid hydroxylase family. The encoded protein is one of two tryptophan hydroxylase enzymes that catalyze the first and rate limiting step in the biosynthesis of the hormone and neurotransmitter, serotonin. This gene is expressed in peripheral organs, while tryptophan hydroxylase 2 is expressed in neurons. The encoded protein is involved in the development of hypoxia-induced elevations in pulmonary pressures and pulmonary vascular remodeling, and has also been implicated as a regulator of immune tolerance. Disruption of this gene is associated with cardiac dysfunction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2013]
PHENOTYPE: Mice homozygous for one null allele display no gross behavioral abnormalities. Mice homozygous for a second null allele display fatigue, breathing difficulties, progressive pallor, and impaired cardiac function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,245,194 S542P probably benign Het
Adamts13 T C 2: 26,973,619 I28T possibly damaging Het
Agbl4 T A 4: 110,478,455 probably benign Het
Aspscr1 G C 11: 120,701,240 V268L probably damaging Het
Btbd10 A G 7: 113,332,875 S115P probably benign Het
Cercam T A 2: 29,871,085 V132E probably damaging Het
Decr1 G A 4: 15,930,976 R119* probably null Het
Dlst T C 12: 85,123,841 M248T probably damaging Het
Erbb3 T C 10: 128,583,454 N215S possibly damaging Het
Flnc G A 6: 29,451,415 V1543M probably damaging Het
Gk5 GCC GC 9: 96,140,629 probably null Het
Glrb T A 3: 80,862,074 R115S probably damaging Het
Gm5592 T A 7: 41,286,354 Y93* probably null Het
Gpr20 C T 15: 73,695,763 R259H probably damaging Het
Il1rap A G 16: 26,692,850 T215A probably benign Het
Ipmk T C 10: 71,381,447 C275R possibly damaging Het
Lats1 A G 10: 7,712,802 N1061S probably benign Het
Nkain3 A G 4: 20,158,329 probably benign Het
Nr1h4 A G 10: 89,483,362 probably benign Het
Nr4a3 A G 4: 48,051,585 Q142R probably benign Het
Otog G A 7: 46,246,503 V131I probably benign Het
Parp12 A T 6: 39,087,571 M627K probably damaging Het
Pcdh9 A G 14: 93,886,209 S842P probably benign Het
Phc2 G C 4: 128,711,113 G214A probably damaging Het
Prpf40a C A 2: 53,176,395 V92L probably benign Het
Qser1 A T 2: 104,786,977 Y1163* probably null Het
Rpe65 A G 3: 159,624,723 D509G probably benign Het
Scin T A 12: 40,073,330 N518I probably damaging Het
Sfswap G T 5: 129,507,137 probably benign Het
Tfpi A T 2: 84,444,116 N182K possibly damaging Het
Ttn T C 2: 76,741,572 T26326A possibly damaging Het
Ubr1 G A 2: 120,934,294 probably benign Het
Usf3 G T 16: 44,220,530 C1791F probably damaging Het
Vmn1r16 T G 6: 57,323,534 R34S probably damaging Het
Ylpm1 C A 12: 85,040,880 P1604Q probably damaging Het
Zc3h12a A G 4: 125,119,364 V569A possibly damaging Het
Zmynd8 A G 2: 165,828,225 F488S probably damaging Het
Other mutations in Tph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Tph1 APN 7 46656870 missense probably benign 0.02
IGL01318:Tph1 APN 7 46665238 missense probably damaging 0.99
IGL01538:Tph1 APN 7 46653753 missense probably damaging 1.00
IGL01564:Tph1 APN 7 46650881 splice site probably benign
IGL02021:Tph1 APN 7 46656997 missense possibly damaging 0.55
IGL02202:Tph1 APN 7 46653761 missense probably benign 0.40
IGL03072:Tph1 APN 7 46652859 missense probably damaging 0.99
R0166:Tph1 UTSW 7 46647596 missense probably damaging 1.00
R0433:Tph1 UTSW 7 46653821 missense probably damaging 1.00
R0485:Tph1 UTSW 7 46650024 missense probably benign 0.00
R0501:Tph1 UTSW 7 46649988 nonsense probably null
R1456:Tph1 UTSW 7 46647483 nonsense probably null
R1474:Tph1 UTSW 7 46653862 missense probably benign 0.00
R1846:Tph1 UTSW 7 46660439 missense probably damaging 0.98
R1967:Tph1 UTSW 7 46662114 missense probably benign 0.30
R2102:Tph1 UTSW 7 46660410 splice site probably null
R2176:Tph1 UTSW 7 46662039 missense possibly damaging 0.91
R2225:Tph1 UTSW 7 46665174 critical splice donor site probably null
R4773:Tph1 UTSW 7 46656952 missense probably damaging 1.00
R4914:Tph1 UTSW 7 46653859 missense probably damaging 1.00
R5590:Tph1 UTSW 7 46653792 missense probably damaging 1.00
R5622:Tph1 UTSW 7 46647545 nonsense probably null
R5960:Tph1 UTSW 7 46662005 critical splice donor site probably null
R5985:Tph1 UTSW 7 46653781 missense probably damaging 1.00
R6362:Tph1 UTSW 7 46647443 missense possibly damaging 0.94
R7151:Tph1 UTSW 7 46662117 missense possibly damaging 0.93
R7329:Tph1 UTSW 7 46656861 splice site probably null
R7395:Tph1 UTSW 7 46657203 splice site probably null
R8012:Tph1 UTSW 7 46656879 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGGAGGAACCAATGTCTCAGTG -3'
(R):5'- GTAACTCAGATCAGAGGTGCCAGC -3'

Sequencing Primer
(F):5'- GAGGAACCAATGTCTCAGTGTATCC -3'
(R):5'- ACATGCCAAAGTCAAGCCCT -3'
Posted On2013-04-16