Incidental Mutation 'I1329:Btbd10'
ID26503
Institutional Source Beutler Lab
Gene Symbol Btbd10
Ensembl Gene ENSMUSG00000038187
Gene NameBTB (POZ) domain containing 10
SynonymsGmrp1, 1110056N09Rik
Accession Numbers

Ncbi RefSeq: NM_133700.2; MGI:1916065

Is this an essential gene? Possibly non essential (E-score: 0.314) question?
Stock #I1329 (G1) of strain toku
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location113315626-113369392 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113332875 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 115 (S115P)
Ref Sequence ENSEMBL: ENSMUSP00000113496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047091] [ENSMUST00000117577] [ENSMUST00000119278] [ENSMUST00000135510]
Predicted Effect probably benign
Transcript: ENSMUST00000047091
AA Change: S107P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048530
Gene: ENSMUSG00000038187
AA Change: S107P

DomainStartEndE-ValueType
low complexity region 60 75 N/A INTRINSIC
low complexity region 106 147 N/A INTRINSIC
BTB 167 272 1.58e-4 SMART
low complexity region 311 322 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117577
AA Change: S115P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113496
Gene: ENSMUSG00000038187
AA Change: S115P

DomainStartEndE-ValueType
low complexity region 68 83 N/A INTRINSIC
low complexity region 114 155 N/A INTRINSIC
BTB 175 280 1.58e-4 SMART
low complexity region 319 330 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119278
AA Change: S59P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113632
Gene: ENSMUSG00000038187
AA Change: S59P

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
low complexity region 58 99 N/A INTRINSIC
BTB 119 224 1.58e-4 SMART
low complexity region 263 274 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135510
AA Change: S107P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114806
Gene: ENSMUSG00000038187
AA Change: S107P

DomainStartEndE-ValueType
low complexity region 60 75 N/A INTRINSIC
low complexity region 106 147 N/A INTRINSIC
SCOP:d1t1da_ 167 198 3e-6 SMART
Blast:BTB 167 200 1e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139650
Meta Mutation Damage Score 0.0728 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 95.2%
Validation Efficiency 89% (42/47)
Allele List at MGI

All alleles(12) : Targeted(2) Gene trapped(10)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,245,194 S542P probably benign Het
Adamts13 T C 2: 26,973,619 I28T possibly damaging Het
Agbl4 T A 4: 110,478,455 probably benign Het
Aspscr1 G C 11: 120,701,240 V268L probably damaging Het
Cercam T A 2: 29,871,085 V132E probably damaging Het
Decr1 G A 4: 15,930,976 R119* probably null Het
Dlst T C 12: 85,123,841 M248T probably damaging Het
Erbb3 T C 10: 128,583,454 N215S possibly damaging Het
Flnc G A 6: 29,451,415 V1543M probably damaging Het
Gk5 GCC GC 9: 96,140,629 probably null Het
Glrb T A 3: 80,862,074 R115S probably damaging Het
Gm5592 T A 7: 41,286,354 Y93* probably null Het
Gpr20 C T 15: 73,695,763 R259H probably damaging Het
Il1rap A G 16: 26,692,850 T215A probably benign Het
Ipmk T C 10: 71,381,447 C275R possibly damaging Het
Lats1 A G 10: 7,712,802 N1061S probably benign Het
Nkain3 A G 4: 20,158,329 probably benign Het
Nr1h4 A G 10: 89,483,362 probably benign Het
Nr4a3 A G 4: 48,051,585 Q142R probably benign Het
Otog G A 7: 46,246,503 V131I probably benign Het
Parp12 A T 6: 39,087,571 M627K probably damaging Het
Pcdh9 A G 14: 93,886,209 S842P probably benign Het
Phc2 G C 4: 128,711,113 G214A probably damaging Het
Prpf40a C A 2: 53,176,395 V92L probably benign Het
Qser1 A T 2: 104,786,977 Y1163* probably null Het
Rpe65 A G 3: 159,624,723 D509G probably benign Het
Scin T A 12: 40,073,330 N518I probably damaging Het
Sfswap G T 5: 129,507,137 probably benign Het
Tfpi A T 2: 84,444,116 N182K possibly damaging Het
Tph1 A G 7: 46,650,013 L368P probably damaging Het
Ttn T C 2: 76,741,572 T26326A possibly damaging Het
Ubr1 G A 2: 120,934,294 probably benign Het
Usf3 G T 16: 44,220,530 C1791F probably damaging Het
Vmn1r16 T G 6: 57,323,534 R34S probably damaging Het
Ylpm1 C A 12: 85,040,880 P1604Q probably damaging Het
Zc3h12a A G 4: 125,119,364 V569A possibly damaging Het
Zmynd8 A G 2: 165,828,225 F488S probably damaging Het
Other mutations in Btbd10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:Btbd10 APN 7 113316556 missense probably damaging 1.00
IGL03223:Btbd10 APN 7 113332670 missense probably damaging 1.00
R0022:Btbd10 UTSW 7 113325781 nonsense probably null
R0022:Btbd10 UTSW 7 113325781 nonsense probably null
R0136:Btbd10 UTSW 7 113329878 missense possibly damaging 0.54
R0299:Btbd10 UTSW 7 113329878 missense possibly damaging 0.54
R0599:Btbd10 UTSW 7 113335309 splice site probably benign
R0657:Btbd10 UTSW 7 113329878 missense possibly damaging 0.54
R1401:Btbd10 UTSW 7 113347059 missense probably benign 0.06
R2916:Btbd10 UTSW 7 113332824 missense probably benign
R3429:Btbd10 UTSW 7 113351809 nonsense probably null
R3430:Btbd10 UTSW 7 113351809 nonsense probably null
R4578:Btbd10 UTSW 7 113322752 missense possibly damaging 0.93
R4626:Btbd10 UTSW 7 113328398 missense probably damaging 0.96
R5067:Btbd10 UTSW 7 113325836 missense probably damaging 0.99
R5480:Btbd10 UTSW 7 113316707 missense probably damaging 1.00
R5667:Btbd10 UTSW 7 113332724 missense probably damaging 1.00
R6468:Btbd10 UTSW 7 113347059 missense probably benign 0.06
R6877:Btbd10 UTSW 7 113322760 missense probably damaging 1.00
R6952:Btbd10 UTSW 7 113351943 splice site probably null
R7059:Btbd10 UTSW 7 113329922 missense probably damaging 0.97
X0027:Btbd10 UTSW 7 113316698 missense probably damaging 1.00
Z1177:Btbd10 UTSW 7 113332689 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- AGTCACTCGCTCAGATGTCCTCAC -3'
(R):5'- TGGCTGGGTCAACATCAATTAGCTTG -3'

Sequencing Primer
(F):5'- AGATGTCCTCACATTCCGAGC -3'
(R):5'- cctggttgtcctggaacttg -3'
Posted On2013-04-16