Incidental Mutation 'R3053:Psg18'
ID 265032
Institutional Source Beutler Lab
Gene Symbol Psg18
Ensembl Gene ENSMUSG00000003505
Gene Name pregnancy specific glycoprotein 18
Synonyms Cea-3, Cea3, mmCGM6
MMRRC Submission 040562-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock # R3053 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 18345422-18355009 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 18349193 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 225 (G225R)
Ref Sequence ENSEMBL: ENSMUSP00000096380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003597] [ENSMUST00000098783]
AlphaFold B2RSG7
Predicted Effect probably damaging
Transcript: ENSMUST00000003597
AA Change: G346R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003597
Gene: ENSMUSG00000003505
AA Change: G346R

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
IG 40 140 2.11e-2 SMART
IG 161 262 1.03e0 SMART
IG 281 380 2.15e-3 SMART
IGc2 398 462 1.58e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098783
AA Change: G225R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096380
Gene: ENSMUSG00000003505
AA Change: G225R

DomainStartEndE-ValueType
IG 40 141 1.03e0 SMART
IG 160 259 2.15e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182983
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183222
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 T C 16: 35,303,716 L1255P probably damaging Het
Agl T A 3: 116,791,033 I213F probably damaging Het
Arap2 A G 5: 62,748,857 V273A probably benign Het
Asb18 T A 1: 89,992,985 H149L probably damaging Het
Axdnd1 T C 1: 156,341,870 T809A probably damaging Het
Bcl11b T C 12: 107,916,001 E613G probably benign Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cyp2a5 A G 7: 26,842,985 I471V possibly damaging Het
Dmtf1 G T 5: 9,129,316 T206K probably damaging Het
Dner G T 1: 84,384,026 Q621K probably damaging Het
Fam92a G C 4: 12,157,767 probably null Het
Gmppa A G 1: 75,441,756 Y261C probably benign Het
Lama5 C T 2: 180,183,067 R2519K probably damaging Het
Mical2 G T 7: 112,311,423 A267S probably damaging Het
Nrxn3 A T 12: 89,255,101 D550V probably damaging Het
Olfr351 T A 2: 36,859,947 M134L probably benign Het
Pole A T 5: 110,289,795 D73V probably damaging Het
Ppm1b G A 17: 85,013,846 R472K probably benign Het
Ppm1m A G 9: 106,198,675 I18T probably benign Het
R3hcc1l T G 19: 42,562,625 Y20* probably null Het
Rapgef1 T C 2: 29,724,856 I817T probably damaging Het
Rasal3 T C 17: 32,403,439 E4G probably benign Het
Ryr1 A T 7: 29,053,090 V3598E probably damaging Het
Slc15a4 A T 5: 127,596,682 V556E possibly damaging Het
Spats2l A G 1: 57,900,766 K193R probably damaging Het
Tacc2 G A 7: 130,625,496 E1323K possibly damaging Het
Tbc1d21 T A 9: 58,363,069 D141V probably damaging Het
Tedc1 G T 12: 113,156,467 probably benign Het
Terf2 A C 8: 107,079,384 L312R possibly damaging Het
Tmem132d A C 5: 127,792,474 S599A probably benign Het
Trp53bp2 T C 1: 182,453,782 F983L probably damaging Het
Ubxn2a T A 12: 4,891,322 K95* probably null Het
Ugt2a2 A T 5: 87,474,469 N213K probably damaging Het
Xpo6 T C 7: 126,104,721 N1086D probably damaging Het
Zbed5 A T 5: 129,902,146 H312L possibly damaging Het
Zfp729b A G 13: 67,593,466 Y227H probably damaging Het
Other mutations in Psg18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Psg18 APN 7 18354816 start codon destroyed probably null 0.99
IGL01748:Psg18 APN 7 18353551 missense probably benign 0.05
IGL01767:Psg18 APN 7 18353397 missense possibly damaging 0.80
IGL02727:Psg18 APN 7 18345950 missense probably damaging 1.00
IGL02744:Psg18 APN 7 18349402 missense probably benign 0.38
G1Funyon:Psg18 UTSW 7 18353377 missense probably damaging 0.99
PIT4466001:Psg18 UTSW 7 18349316 missense probably benign 0.30
R0331:Psg18 UTSW 7 18353308 missense probably benign 0.03
R1077:Psg18 UTSW 7 18351075 missense possibly damaging 0.84
R1171:Psg18 UTSW 7 18346079 missense probably benign 0.10
R1173:Psg18 UTSW 7 18354817 start codon destroyed probably null 0.97
R1234:Psg18 UTSW 7 18349190 missense probably damaging 1.00
R1553:Psg18 UTSW 7 18353481 missense probably benign 0.19
R1632:Psg18 UTSW 7 18350899 missense probably benign 0.02
R2108:Psg18 UTSW 7 18350874 missense probably damaging 1.00
R2439:Psg18 UTSW 7 18346119 missense probably benign 0.24
R3032:Psg18 UTSW 7 18350979 missense probably benign 0.01
R3432:Psg18 UTSW 7 18349171 missense possibly damaging 0.61
R3725:Psg18 UTSW 7 18354823 start gained probably benign
R4479:Psg18 UTSW 7 18350862 missense probably benign 0.01
R4480:Psg18 UTSW 7 18350862 missense probably benign 0.01
R4846:Psg18 UTSW 7 18350786 nonsense probably null
R4858:Psg18 UTSW 7 18353484 missense possibly damaging 0.49
R5010:Psg18 UTSW 7 18349354 missense probably damaging 1.00
R5225:Psg18 UTSW 7 18345949 missense probably damaging 1.00
R5450:Psg18 UTSW 7 18353425 missense probably benign 0.32
R5526:Psg18 UTSW 7 18349348 missense probably damaging 1.00
R5840:Psg18 UTSW 7 18346602 intron probably benign
R6409:Psg18 UTSW 7 18353521 missense probably benign
R7164:Psg18 UTSW 7 18350937 missense possibly damaging 0.89
R7276:Psg18 UTSW 7 18345984 missense probably damaging 0.99
R7768:Psg18 UTSW 7 18346028 missense probably damaging 1.00
R8301:Psg18 UTSW 7 18353377 missense probably damaging 0.99
R8700:Psg18 UTSW 7 18353625 missense probably damaging 1.00
R8982:Psg18 UTSW 7 18349375 missense probably benign 0.20
R9042:Psg18 UTSW 7 18349122 missense probably benign 0.44
R9054:Psg18 UTSW 7 18353525 missense possibly damaging 0.82
Z1176:Psg18 UTSW 7 18354787 missense probably benign 0.07
Z1177:Psg18 UTSW 7 18349115 missense probably benign 0.30
Z1177:Psg18 UTSW 7 18349198 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TTGGTACAGCCCATGTGTGC -3'
(R):5'- GGAAGTGTTCTTCTCCAGGTCC -3'

Sequencing Primer
(F):5'- GTGCCCAAATACCAATGTGATG -3'
(R):5'- GTCCATAATCTGCCAGAAGATGTGC -3'
Posted On 2015-02-05