Mutagenetix > Incidental Mutation

Incidental Mutation 'I1329:Lats1'

26504

Institutional Source

Beutler Lab

Gene Symbol

Lats1

Ensembl Gene

ENSMUSG00000040021

Gene Name

large tumor suppressor

Synonyms

Accession Numbers

Essential gene?

Probably essential (E-score: 0.890) question?

Stock #

I1329 (G1) of strain toku

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

7681214-7716460 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 7712802 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 1061 (N1061S)

Ref Sequence

ENSEMBL: ENSMUSP00000151533 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040043] [ENSMUST00000165952] [ENSMUST00000217931]

AlphaFold

Q8BYR2

Predicted Effect

probably benign
Transcript: ENSMUST00000040043
AA Change: N1061S

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000041915
Gene: ENSMUSG00000040021
AA Change: N1061S

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000165952
AA Change: N1061S

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000132078
Gene: ENSMUSG00000040021
AA Change: N1061S

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000217931
AA Change: N1061S

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)

Meta Mutation Damage Score

0.0599

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.9%
20x: 95.2%

Validation Efficiency

89% (42/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. Two protein-coding transcripts and one non-protein coding transcript have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high postnatal mortality, lack of mammary development, infertility, pituitary hyperplasia, reduced hormone levels, growth retardation, and susceptibility to sarcomas and ovarian stromal cell tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	A	G	7: 34,245,194	S542P	probably benign	Het
Adamts13	T	C	2: 26,973,619	I28T	possibly damaging	Het
Agbl4	T	A	4: 110,478,455		probably benign	Het
Aspscr1	G	C	11: 120,701,240	V268L	probably damaging	Het
Btbd10	A	G	7: 113,332,875	S115P	probably benign	Het
Cercam	T	A	2: 29,871,085	V132E	probably damaging	Het
Decr1	G	A	4: 15,930,976	R119*	probably null	Het
Dlst	T	C	12: 85,123,841	M248T	probably damaging	Het
Erbb3	T	C	10: 128,583,454	N215S	possibly damaging	Het
Flnc	G	A	6: 29,451,415	V1543M	probably damaging	Het
Gk5	GCC	GC	9: 96,140,629		probably null	Het
Glrb	T	A	3: 80,862,074	R115S	probably damaging	Het
Gm5592	T	A	7: 41,286,354	Y93*	probably null	Het
Gpr20	C	T	15: 73,695,763	R259H	probably damaging	Het
Il1rap	A	G	16: 26,692,850	T215A	probably benign	Het
Ipmk	T	C	10: 71,381,447	C275R	possibly damaging	Het
Nkain3	A	G	4: 20,158,329		probably benign	Het
Nr1h4	A	G	10: 89,483,362		probably benign	Het
Nr4a3	A	G	4: 48,051,585	Q142R	probably benign	Het
Otog	G	A	7: 46,246,503	V131I	probably benign	Het
Parp12	A	T	6: 39,087,571	M627K	probably damaging	Het
Pcdh9	A	G	14: 93,886,209	S842P	probably benign	Het
Phc2	G	C	4: 128,711,113	G214A	probably damaging	Het
Prpf40a	C	A	2: 53,176,395	V92L	probably benign	Het
Qser1	A	T	2: 104,786,977	Y1163*	probably null	Het
Rpe65	A	G	3: 159,624,723	D509G	probably benign	Het
Scin	T	A	12: 40,073,330	N518I	probably damaging	Het
Sfswap	G	T	5: 129,507,137		probably benign	Het
Tfpi	A	T	2: 84,444,116	N182K	possibly damaging	Het
Tph1	A	G	7: 46,650,013	L368P	probably damaging	Het
Ttn	T	C	2: 76,741,572	T26326A	possibly damaging	Het
Ubr1	G	A	2: 120,934,294		probably benign	Het
Usf3	G	T	16: 44,220,530	C1791F	probably damaging	Het
Vmn1r16	T	G	6: 57,323,534	R34S	probably damaging	Het
Ylpm1	C	A	12: 85,040,880	P1604Q	probably damaging	Het
Zc3h12a	A	G	4: 125,119,364	V569A	possibly damaging	Het
Zmynd8	A	G	2: 165,828,225	F488S	probably damaging	Het

Other mutations in Lats1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Lats1	APN	10	7691566	missense	probably damaging	0.99
IGL00595:Lats1	APN	10	7702305	missense	probably benign	0.00
IGL00932:Lats1	APN	10	7712742	missense	possibly damaging	0.69
IGL01019:Lats1	APN	10	7705671	missense	probably damaging	1.00
IGL01380:Lats1	APN	10	7691780	missense	possibly damaging	0.69
IGL01965:Lats1	APN	10	7701706	missense	probably benign	0.10
IGL02027:Lats1	APN	10	7712948	missense	probably benign
IGL02611:Lats1	APN	10	7705787	missense	possibly damaging	0.91
IGL02997:Lats1	APN	10	7702254	missense	possibly damaging	0.53
IGL03107:Lats1	APN	10	7712746	missense	probably benign	0.15
PIT4378001:Lats1	UTSW	10	7705605	missense	probably damaging	1.00
R0153:Lats1	UTSW	10	7691575	missense	probably damaging	1.00
R0568:Lats1	UTSW	10	7712528	missense	possibly damaging	0.69
R0581:Lats1	UTSW	10	7702941	missense	possibly damaging	0.67
R0604:Lats1	UTSW	10	7712661	missense	probably damaging	0.96
R1681:Lats1	UTSW	10	7705914	missense	probably damaging	0.99
R1694:Lats1	UTSW	10	7701945	missense	probably benign	0.07
R1840:Lats1	UTSW	10	7710939	nonsense	probably null
R1914:Lats1	UTSW	10	7710457	splice site	probably benign
R2137:Lats1	UTSW	10	7701847	missense	possibly damaging	0.71
R2317:Lats1	UTSW	10	7691776	nonsense	probably null
R3863:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R3864:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R4597:Lats1	UTSW	10	7691746	missense	probably benign	0.00
R4657:Lats1	UTSW	10	7705684	missense	possibly damaging	0.82
R4658:Lats1	UTSW	10	7702729	missense	probably benign
R4663:Lats1	UTSW	10	7712583	missense	probably damaging	1.00
R4870:Lats1	UTSW	10	7705785	missense	probably damaging	1.00
R5101:Lats1	UTSW	10	7712584	nonsense	probably null
R5134:Lats1	UTSW	10	7691811	missense	probably benign	0.34
R5150:Lats1	UTSW	10	7712651	missense	probably benign
R5546:Lats1	UTSW	10	7705754	missense	probably damaging	0.99
R5820:Lats1	UTSW	10	7705908	missense	probably damaging	1.00
R6006:Lats1	UTSW	10	7705595	missense	probably damaging	1.00
R6301:Lats1	UTSW	10	7703107	missense	probably benign	0.01
R6544:Lats1	UTSW	10	7701670	missense	possibly damaging	0.94
R6647:Lats1	UTSW	10	7697507	missense	possibly damaging	0.81
R6874:Lats1	UTSW	10	7710851	missense	probably damaging	1.00
R7328:Lats1	UTSW	10	7705547	missense	possibly damaging	0.62
R7390:Lats1	UTSW	10	7702095	nonsense	probably null
R7438:Lats1	UTSW	10	7712942	nonsense	probably null
R7457:Lats1	UTSW	10	7710891	missense	probably damaging	1.00
R7524:Lats1	UTSW	10	7701978	missense	possibly damaging	0.89
R7593:Lats1	UTSW	10	7701712	missense	probably damaging	1.00
R7736:Lats1	UTSW	10	7702364	missense	probably damaging	1.00
R7884:Lats1	UTSW	10	7697526	nonsense	probably null
R8166:Lats1	UTSW	10	7702116	missense	probably benign
R8248:Lats1	UTSW	10	7705903	missense	probably damaging	1.00
R8458:Lats1	UTSW	10	7710924	nonsense	probably null
R8477:Lats1	UTSW	10	7705515	missense	probably damaging	1.00
R8547:Lats1	UTSW	10	7712849	missense	probably damaging	1.00
R9163:Lats1	UTSW	10	7702288	missense	probably benign
R9441:Lats1	UTSW	10	7702917	missense	probably damaging	0.96
R9673:Lats1	UTSW	10	7712623	missense	probably benign	0.29
RF021:Lats1	UTSW	10	7710608	missense	probably damaging	1.00
X0026:Lats1	UTSW	10	7710623	missense	probably damaging	1.00
X0053:Lats1	UTSW	10	7691609	missense	probably benign	0.00
Z1176:Lats1	UTSW	10	7705809	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAAGCTAAGCTGAGTCCTGAAGCC -3'
(R):5'- CAGACTGTTGTTCTGAGCCCTGTG -3'

Sequencing Primer
(F):5'- TCAAACTTTGTCGAGGACCAG -3'
(R):5'- TCTGAGCCCTGTGAATGAATG -3'

Posted On

2013-04-16