Incidental Mutation 'R3053:Ubxn2a'
ID265042
Institutional Source Beutler Lab
Gene Symbol Ubxn2a
Ensembl Gene ENSMUSG00000020634
Gene NameUBX domain protein 2A
Synonyms6330407P03Rik, Ubxd4
MMRRC Submission 040562-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.773) question?
Stock #R3053 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location4879032-4907705 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 4891322 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 95 (K95*)
Ref Sequence ENSEMBL: ENSMUSP00000118834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020962] [ENSMUST00000141360] [ENSMUST00000142867]
Predicted Effect probably null
Transcript: ENSMUST00000020962
AA Change: K95*
SMART Domains Protein: ENSMUSP00000020962
Gene: ENSMUSG00000020634
AA Change: K95*

DomainStartEndE-ValueType
SEP 58 151 1.52e-25 SMART
UBX 167 248 4.07e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141360
Predicted Effect probably null
Transcript: ENSMUST00000142867
AA Change: K95*
SMART Domains Protein: ENSMUSP00000118834
Gene: ENSMUSG00000020634
AA Change: K95*

DomainStartEndE-ValueType
SEP 58 151 1.52e-25 SMART
UBX 167 248 4.07e-3 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 T C 16: 35,303,716 L1255P probably damaging Het
Agl T A 3: 116,791,033 I213F probably damaging Het
Arap2 A G 5: 62,748,857 V273A probably benign Het
Asb18 T A 1: 89,992,985 H149L probably damaging Het
Axdnd1 T C 1: 156,341,870 T809A probably damaging Het
Bcl11b T C 12: 107,916,001 E613G probably benign Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cyp2a5 A G 7: 26,842,985 I471V possibly damaging Het
Dmtf1 G T 5: 9,129,316 T206K probably damaging Het
Dner G T 1: 84,384,026 Q621K probably damaging Het
Fam92a G C 4: 12,157,767 probably null Het
Gmppa A G 1: 75,441,756 Y261C probably benign Het
Lama5 C T 2: 180,183,067 R2519K probably damaging Het
Mical2 G T 7: 112,311,423 A267S probably damaging Het
Nrxn3 A T 12: 89,255,101 D550V probably damaging Het
Olfr351 T A 2: 36,859,947 M134L probably benign Het
Pole A T 5: 110,289,795 D73V probably damaging Het
Ppm1b G A 17: 85,013,846 R472K probably benign Het
Ppm1m A G 9: 106,198,675 I18T probably benign Het
Psg18 C T 7: 18,349,193 G225R probably damaging Het
R3hcc1l T G 19: 42,562,625 Y20* probably null Het
Rapgef1 T C 2: 29,724,856 I817T probably damaging Het
Rasal3 T C 17: 32,403,439 E4G probably benign Het
Ryr1 A T 7: 29,053,090 V3598E probably damaging Het
Slc15a4 A T 5: 127,596,682 V556E possibly damaging Het
Spats2l A G 1: 57,900,766 K193R probably damaging Het
Tacc2 G A 7: 130,625,496 E1323K possibly damaging Het
Tbc1d21 T A 9: 58,363,069 D141V probably damaging Het
Tedc1 G T 12: 113,156,467 probably benign Het
Terf2 A C 8: 107,079,384 L312R possibly damaging Het
Tmem132d A C 5: 127,792,474 S599A probably benign Het
Trp53bp2 T C 1: 182,453,782 F983L probably damaging Het
Ugt2a2 A T 5: 87,474,469 N213K probably damaging Het
Xpo6 T C 7: 126,104,721 N1086D probably damaging Het
Zbed5 A T 5: 129,902,146 H312L possibly damaging Het
Zfp729b A G 13: 67,593,466 Y227H probably damaging Het
Other mutations in Ubxn2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00956:Ubxn2a APN 12 4883956 missense probably benign 0.00
R0611:Ubxn2a UTSW 12 4880700 missense probably damaging 1.00
R0900:Ubxn2a UTSW 12 4902257 missense probably damaging 1.00
R1808:Ubxn2a UTSW 12 4885839 missense probably benign 0.00
R1883:Ubxn2a UTSW 12 4894563 nonsense probably null
R2163:Ubxn2a UTSW 12 4885757 missense probably damaging 1.00
R2404:Ubxn2a UTSW 12 4883851 missense probably benign 0.00
R3051:Ubxn2a UTSW 12 4891322 nonsense probably null
R3052:Ubxn2a UTSW 12 4891322 nonsense probably null
R4204:Ubxn2a UTSW 12 4894593 missense probably damaging 1.00
R5088:Ubxn2a UTSW 12 4883904 missense probably damaging 1.00
R5182:Ubxn2a UTSW 12 4880634 missense probably damaging 1.00
R5366:Ubxn2a UTSW 12 4880741 missense probably benign 0.04
R5518:Ubxn2a UTSW 12 4902238 missense probably benign 0.31
R7414:Ubxn2a UTSW 12 4891381 missense probably damaging 1.00
R7613:Ubxn2a UTSW 12 4883832 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TGGATTTCAAGGCTAGCTGAG -3'
(R):5'- AGAGTTGAGAGGACTTCACTTATG -3'

Sequencing Primer
(F):5'- AGAGGATGTTGGACACCCCTAC -3'
(R):5'- GAGAGGACTTCACTTATGACTATCGC -3'
Posted On2015-02-05