Incidental Mutation 'R3054:Bard1'
ID265056
Institutional Source Beutler Lab
Gene Symbol Bard1
Ensembl Gene ENSMUSG00000026196
Gene NameBRCA1 associated RING domain 1
SynonymsENSMUSG00000060893, ENSMUSG00000073653
MMRRC Submission 040563-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3054 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location71027498-71103146 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71088231 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 73 (V73A)
Ref Sequence ENSEMBL: ENSMUSP00000027393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027393]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027393
AA Change: V73A

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000027393
Gene: ENSMUSG00000026196
AA Change: V73A

DomainStartEndE-ValueType
low complexity region 32 43 N/A INTRINSIC
RING 44 80 3.71e-2 SMART
low complexity region 225 232 N/A INTRINSIC
low complexity region 371 390 N/A INTRINSIC
ANK 415 444 3.46e-4 SMART
ANK 448 477 8.32e-7 SMART
ANK 481 510 1.55e-6 SMART
BRCT 553 631 3.56e-10 SMART
BRCT 657 758 2.35e-10 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which interacts with the N-terminal region of BRCA1. In addition to its ability to bind BRCA1 in vivo and in vitro, it shares homology with the 2 most conserved regions of BRCA1: the N-terminal RING motif and the C-terminal BRCT domain. The RING motif is a cysteine-rich sequence found in a variety of proteins that regulate cell growth, including the products of tumor suppressor genes and dominant protooncogenes. This protein also contains 3 tandem ankyrin repeats. The BARD1/BRCA1 interaction is disrupted by tumorigenic amino acid substitutions in BRCA1, implying that the formation of a stable complex between these proteins may be an essential aspect of BRCA1 tumor suppression. This protein may be the target of oncogenic mutations in breast or ovarian cancer. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for disruptions of this gene fail to develop past the egg cylinder stage. The phenotype is similar to that of mice with homozygous for disruptions in Brca1 or homozygous for disruptions in both Bard1 and Brca1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik A T 6: 52,179,128 probably benign Het
Aldh1l2 T C 10: 83,502,472 K528E probably benign Het
Als2 A G 1: 59,215,494 C235R probably damaging Het
Armc6 C A 8: 70,225,149 V177L probably benign Het
Asb7 A T 7: 66,679,211 V27D probably damaging Het
Ccdc150 A G 1: 54,288,842 N361S possibly damaging Het
Cntn5 A G 9: 10,419,071 L7P probably benign Het
Cst3 A G 2: 148,872,031 S118P probably damaging Het
Cyp2a22 T C 7: 26,938,829 D84G probably damaging Het
D330045A20Rik T A X: 139,511,557 V439E possibly damaging Het
Ddo A G 10: 40,631,742 N45S probably benign Het
Drd4 T C 7: 141,294,479 V319A probably damaging Het
Fat3 C T 9: 15,960,496 R3533H probably benign Het
Fras1 A T 5: 96,764,943 I3369F probably damaging Het
Gm5591 T C 7: 38,520,634 S272G probably benign Het
Gm8444 A T 15: 81,843,644 probably benign Het
Gm9776 A G 13: 94,358,650 probably benign Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Larp1b A T 3: 40,964,100 I59F probably benign Het
Ltn1 C T 16: 87,404,073 A1092T probably benign Het
Map1b A G 13: 99,432,742 V1157A unknown Het
Mboat1 A T 13: 30,195,741 M92L probably benign Het
Meis3 G T 7: 16,182,453 L284F probably damaging Het
Muc20 T C 16: 32,779,029 F3317L probably benign Het
Muc5b G T 7: 141,864,041 V3575F probably damaging Het
Polr1e C T 4: 45,018,724 T18I possibly damaging Het
Ppp4r1 G T 17: 65,836,079 A764S probably damaging Het
Psg29 A G 7: 17,208,802 T243A probably benign Het
Ptprn2 T C 12: 116,722,133 Y71H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sh3bp1 C T 15: 78,911,422 P584S probably benign Het
Slc4a4 T C 5: 89,225,948 V971A probably damaging Het
Stil T A 4: 115,004,966 H35Q probably damaging Het
Strn A T 17: 78,682,892 V65D probably damaging Het
Sumf1 T C 6: 108,153,204 N185D probably benign Het
Timm29 T C 9: 21,593,591 M185T probably damaging Het
Tjp3 T C 10: 81,280,507 K251R probably benign Het
Tubgcp6 A T 15: 89,122,603 M72K probably damaging Het
Utp14b T A 1: 78,664,725 D113E possibly damaging Het
Vps13b A G 15: 35,646,361 E1537G probably damaging Het
Zfr A G 15: 12,154,507 N592S probably damaging Het
Other mutations in Bard1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Bard1 APN 1 71031426 missense probably benign 0.08
IGL02128:Bard1 APN 1 71075228 missense possibly damaging 0.66
IGL02249:Bard1 APN 1 71053669 missense probably damaging 1.00
IGL02552:Bard1 APN 1 71065656 splice site probably benign
IGL02661:Bard1 APN 1 71075310 missense probably damaging 1.00
IGL03087:Bard1 APN 1 71067130 missense probably damaging 1.00
PIT4651001:Bard1 UTSW 1 71074928 missense probably benign 0.00
R0096:Bard1 UTSW 1 71053730 splice site probably benign
R0328:Bard1 UTSW 1 71046762 missense probably benign 0.29
R0838:Bard1 UTSW 1 71030653 missense probably damaging 1.00
R2007:Bard1 UTSW 1 71031403 missense probably benign 0.00
R2055:Bard1 UTSW 1 71074872 missense probably benign 0.00
R2110:Bard1 UTSW 1 71075391 nonsense probably null
R2237:Bard1 UTSW 1 71074976 missense probably damaging 1.00
R2416:Bard1 UTSW 1 71074652 missense probably benign
R3055:Bard1 UTSW 1 71088231 missense possibly damaging 0.77
R3056:Bard1 UTSW 1 71088231 missense possibly damaging 0.77
R3871:Bard1 UTSW 1 71074940 missense probably benign 0.05
R3905:Bard1 UTSW 1 71067180 missense possibly damaging 0.70
R4117:Bard1 UTSW 1 71046763 missense probably damaging 1.00
R4766:Bard1 UTSW 1 71075174 missense probably benign 0.01
R5230:Bard1 UTSW 1 71053611 critical splice donor site probably null
R5250:Bard1 UTSW 1 71074563 missense probably damaging 1.00
R5531:Bard1 UTSW 1 71046721 missense probably damaging 1.00
R5653:Bard1 UTSW 1 71031429 missense probably benign
R6008:Bard1 UTSW 1 71030750 missense possibly damaging 0.65
R7503:Bard1 UTSW 1 71030836 missense probably damaging 1.00
R7543:Bard1 UTSW 1 71075430 missense probably damaging 1.00
R7750:Bard1 UTSW 1 71066942 intron probably null
V8831:Bard1 UTSW 1 71088217 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCTCCTAACTCCTCTGG -3'
(R):5'- GCAGATTGTCGTGCTAAATAATGTC -3'

Sequencing Primer
(F):5'- AACTCCTCTGGACCTTAGGATC -3'
(R):5'- TGTCGTGCTAAATAATGTCTCTATG -3'
Posted On2015-02-05