Incidental Mutation 'R3054:Utp14b'
ID265058
Institutional Source Beutler Lab
Gene Symbol Utp14b
Ensembl Gene ENSMUSG00000079470
Gene NameUTP14B small subunit processome component
Synonyms4932411L21Rik, jsd
MMRRC Submission 040563-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3054 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location78658038-78671512 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 78664725 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 113 (D113E)
Ref Sequence ENSEMBL: ENSMUSP00000121391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035779] [ENSMUST00000053760] [ENSMUST00000134566] [ENSMUST00000142704] [ENSMUST00000151622]
Predicted Effect probably benign
Transcript: ENSMUST00000035779
SMART Domains Protein: ENSMUSP00000045291
Gene: ENSMUSG00000032883

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 113 587 2e-94 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000053760
AA Change: D113E

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000052149
Gene: ENSMUSG00000079470
AA Change: D113E

DomainStartEndE-ValueType
Pfam:Utp14 39 744 6.4e-205 PFAM
low complexity region 758 778 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134566
SMART Domains Protein: ENSMUSP00000117952
Gene: ENSMUSG00000032883

DomainStartEndE-ValueType
Pfam:AMP-binding 1 435 4.3e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142704
SMART Domains Protein: ENSMUSP00000121695
Gene: ENSMUSG00000032883

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 113 587 2.5e-106 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000151622
AA Change: D113E

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121391
Gene: ENSMUSG00000079470
AA Change: D113E

DomainStartEndE-ValueType
Pfam:Utp14 45 743 6e-163 PFAM
low complexity region 758 778 N/A INTRINSIC
Meta Mutation Damage Score 0.3247 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous males are sterile with spermatogonial arrest and elevated intratesticular testosterone levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik A T 6: 52,179,128 probably benign Het
Aldh1l2 T C 10: 83,502,472 K528E probably benign Het
Als2 A G 1: 59,215,494 C235R probably damaging Het
Armc6 C A 8: 70,225,149 V177L probably benign Het
Asb7 A T 7: 66,679,211 V27D probably damaging Het
Bard1 A G 1: 71,088,231 V73A possibly damaging Het
Ccdc150 A G 1: 54,288,842 N361S possibly damaging Het
Cntn5 A G 9: 10,419,071 L7P probably benign Het
Cst3 A G 2: 148,872,031 S118P probably damaging Het
Cyp2a22 T C 7: 26,938,829 D84G probably damaging Het
D330045A20Rik T A X: 139,511,557 V439E possibly damaging Het
Ddo A G 10: 40,631,742 N45S probably benign Het
Drd4 T C 7: 141,294,479 V319A probably damaging Het
Fat3 C T 9: 15,960,496 R3533H probably benign Het
Fras1 A T 5: 96,764,943 I3369F probably damaging Het
Gm5591 T C 7: 38,520,634 S272G probably benign Het
Gm8444 A T 15: 81,843,644 probably benign Het
Gm9776 A G 13: 94,358,650 probably benign Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Larp1b A T 3: 40,964,100 I59F probably benign Het
Ltn1 C T 16: 87,404,073 A1092T probably benign Het
Map1b A G 13: 99,432,742 V1157A unknown Het
Mboat1 A T 13: 30,195,741 M92L probably benign Het
Meis3 G T 7: 16,182,453 L284F probably damaging Het
Muc20 T C 16: 32,779,029 F3317L probably benign Het
Muc5b G T 7: 141,864,041 V3575F probably damaging Het
Polr1e C T 4: 45,018,724 T18I possibly damaging Het
Ppp4r1 G T 17: 65,836,079 A764S probably damaging Het
Psg29 A G 7: 17,208,802 T243A probably benign Het
Ptprn2 T C 12: 116,722,133 Y71H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sh3bp1 C T 15: 78,911,422 P584S probably benign Het
Slc4a4 T C 5: 89,225,948 V971A probably damaging Het
Stil T A 4: 115,004,966 H35Q probably damaging Het
Strn A T 17: 78,682,892 V65D probably damaging Het
Sumf1 T C 6: 108,153,204 N185D probably benign Het
Timm29 T C 9: 21,593,591 M185T probably damaging Het
Tjp3 T C 10: 81,280,507 K251R probably benign Het
Tubgcp6 A T 15: 89,122,603 M72K probably damaging Het
Vps13b A G 15: 35,646,361 E1537G probably damaging Het
Zfr A G 15: 12,154,507 N592S probably damaging Het
Other mutations in Utp14b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Utp14b APN 1 78664545 missense probably damaging 1.00
IGL01837:Utp14b APN 1 78664919 missense probably damaging 1.00
IGL02895:Utp14b APN 1 78664607 missense possibly damaging 0.61
IGL03165:Utp14b APN 1 78664520 missense probably damaging 0.97
IGL03210:Utp14b APN 1 78665551 missense probably benign 0.02
R0662:Utp14b UTSW 1 78664999 missense probably damaging 1.00
R0671:Utp14b UTSW 1 78664735 missense probably benign 0.00
R0736:Utp14b UTSW 1 78665272 missense probably damaging 1.00
R1180:Utp14b UTSW 1 78665445 missense probably damaging 1.00
R1430:Utp14b UTSW 1 78666394 missense probably benign 0.25
R1448:Utp14b UTSW 1 78665445 missense probably damaging 1.00
R1641:Utp14b UTSW 1 78665939 missense probably benign 0.08
R1867:Utp14b UTSW 1 78665431 missense probably damaging 1.00
R3055:Utp14b UTSW 1 78664725 missense possibly damaging 0.91
R3056:Utp14b UTSW 1 78664725 missense possibly damaging 0.91
R3426:Utp14b UTSW 1 78665339 missense probably damaging 1.00
R3744:Utp14b UTSW 1 78665256 missense probably benign 0.03
R4204:Utp14b UTSW 1 78664822 missense probably benign 0.12
R5570:Utp14b UTSW 1 78665401 missense probably damaging 1.00
R5574:Utp14b UTSW 1 78666409 missense probably damaging 1.00
R5958:Utp14b UTSW 1 78664942 nonsense probably null
R5958:Utp14b UTSW 1 78664943 missense probably damaging 1.00
R6173:Utp14b UTSW 1 78665837 missense probably benign 0.03
R6173:Utp14b UTSW 1 78665840 missense probably benign 0.00
R7258:Utp14b UTSW 1 78664974 missense probably benign 0.30
R7784:Utp14b UTSW 1 78664943 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AAACTATCCACTGAGTACGAGTG -3'
(R):5'- AATCAACTGCTCTGCCTGCC -3'

Sequencing Primer
(F):5'- CTATCCACTGAGTACGAGTGAAGATG -3'
(R):5'- GTTCTTCAGAACCACCGGATC -3'
Posted On2015-02-05