Incidental Mutation 'R3054:Larp1b'
ID265060
Institutional Source Beutler Lab
Gene Symbol Larp1b
Ensembl Gene ENSMUSG00000025762
Gene NameLa ribonucleoprotein domain family, member 1B
SynonymsLarp2, 1700108L22Rik, 4933421B21Rik
MMRRC Submission 040563-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3054 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location40950354-41040234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 40964100 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 59 (I59F)
Ref Sequence ENSEMBL: ENSMUSP00000141487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048490] [ENSMUST00000191805] [ENSMUST00000191872] [ENSMUST00000200432]
Predicted Effect probably benign
Transcript: ENSMUST00000048490
AA Change: I59F

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000037127
Gene: ENSMUSG00000025762
AA Change: I59F

DomainStartEndE-ValueType
low complexity region 28 49 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
low complexity region 138 164 N/A INTRINSIC
LA 213 291 4.35e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191805
AA Change: I59F

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000141487
Gene: ENSMUSG00000025762
AA Change: I59F

DomainStartEndE-ValueType
low complexity region 28 49 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
low complexity region 138 164 N/A INTRINSIC
LA 213 291 4.35e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191872
AA Change: I59F

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000142106
Gene: ENSMUSG00000025762
AA Change: I59F

DomainStartEndE-ValueType
low complexity region 28 49 N/A INTRINSIC
low complexity region 70 86 N/A INTRINSIC
low complexity region 91 117 N/A INTRINSIC
LA 166 244 4.35e-37 SMART
Predicted Effect unknown
Transcript: ENSMUST00000193795
AA Change: I40F
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197092
Predicted Effect probably benign
Transcript: ENSMUST00000200432
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik A T 6: 52,179,128 probably benign Het
Aldh1l2 T C 10: 83,502,472 K528E probably benign Het
Als2 A G 1: 59,215,494 C235R probably damaging Het
Armc6 C A 8: 70,225,149 V177L probably benign Het
Asb7 A T 7: 66,679,211 V27D probably damaging Het
Bard1 A G 1: 71,088,231 V73A possibly damaging Het
Ccdc150 A G 1: 54,288,842 N361S possibly damaging Het
Cntn5 A G 9: 10,419,071 L7P probably benign Het
Cst3 A G 2: 148,872,031 S118P probably damaging Het
Cyp2a22 T C 7: 26,938,829 D84G probably damaging Het
D330045A20Rik T A X: 139,511,557 V439E possibly damaging Het
Ddo A G 10: 40,631,742 N45S probably benign Het
Drd4 T C 7: 141,294,479 V319A probably damaging Het
Fat3 C T 9: 15,960,496 R3533H probably benign Het
Fras1 A T 5: 96,764,943 I3369F probably damaging Het
Gm5591 T C 7: 38,520,634 S272G probably benign Het
Gm8444 A T 15: 81,843,644 probably benign Het
Gm9776 A G 13: 94,358,650 probably benign Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Ltn1 C T 16: 87,404,073 A1092T probably benign Het
Map1b A G 13: 99,432,742 V1157A unknown Het
Mboat1 A T 13: 30,195,741 M92L probably benign Het
Meis3 G T 7: 16,182,453 L284F probably damaging Het
Muc20 T C 16: 32,779,029 F3317L probably benign Het
Muc5b G T 7: 141,864,041 V3575F probably damaging Het
Polr1e C T 4: 45,018,724 T18I possibly damaging Het
Ppp4r1 G T 17: 65,836,079 A764S probably damaging Het
Psg29 A G 7: 17,208,802 T243A probably benign Het
Ptprn2 T C 12: 116,722,133 Y71H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sh3bp1 C T 15: 78,911,422 P584S probably benign Het
Slc4a4 T C 5: 89,225,948 V971A probably damaging Het
Stil T A 4: 115,004,966 H35Q probably damaging Het
Strn A T 17: 78,682,892 V65D probably damaging Het
Sumf1 T C 6: 108,153,204 N185D probably benign Het
Timm29 T C 9: 21,593,591 M185T probably damaging Het
Tjp3 T C 10: 81,280,507 K251R probably benign Het
Tubgcp6 A T 15: 89,122,603 M72K probably damaging Het
Utp14b T A 1: 78,664,725 D113E possibly damaging Het
Vps13b A G 15: 35,646,361 E1537G probably damaging Het
Zfr A G 15: 12,154,507 N592S probably damaging Het
Other mutations in Larp1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01506:Larp1b APN 3 41033440 nonsense probably null
IGL01636:Larp1b APN 3 40970478 missense probably benign 0.35
IGL01845:Larp1b APN 3 40970525 missense probably benign 0.03
IGL02192:Larp1b APN 3 40967494 missense probably benign 0.01
IGL03372:Larp1b APN 3 41024527 missense possibly damaging 0.79
R0396:Larp1b UTSW 3 40970561 missense probably damaging 1.00
R0512:Larp1b UTSW 3 40970034 missense probably benign 0.00
R0975:Larp1b UTSW 3 40970490 missense probably damaging 0.99
R1119:Larp1b UTSW 3 41033528 missense possibly damaging 0.87
R1337:Larp1b UTSW 3 41033402 missense probably damaging 1.00
R1460:Larp1b UTSW 3 40962218 missense probably benign
R1565:Larp1b UTSW 3 40972384 missense probably damaging 1.00
R1589:Larp1b UTSW 3 41033474 missense probably damaging 1.00
R1640:Larp1b UTSW 3 41034072 start codon destroyed probably null 0.04
R1899:Larp1b UTSW 3 40964084 missense probably benign 0.04
R2133:Larp1b UTSW 3 40970535 missense possibly damaging 0.69
R4621:Larp1b UTSW 3 40963989 missense possibly damaging 0.71
R4818:Larp1b UTSW 3 40970570 missense probably damaging 1.00
R5023:Larp1b UTSW 3 41033985 missense possibly damaging 0.88
R5166:Larp1b UTSW 3 40964052 nonsense probably null
R5357:Larp1b UTSW 3 41024515 missense probably benign 0.04
R5364:Larp1b UTSW 3 40977223 missense probably damaging 0.99
R5492:Larp1b UTSW 3 40969899 missense probably damaging 0.99
R5495:Larp1b UTSW 3 41035822 missense probably damaging 1.00
R7070:Larp1b UTSW 3 40976651 missense probably damaging 1.00
R7293:Larp1b UTSW 3 40985444 missense
R7615:Larp1b UTSW 3 41033534 missense possibly damaging 0.79
R7615:Larp1b UTSW 3 41035816 missense probably benign 0.01
R7717:Larp1b UTSW 3 40972444 missense probably damaging 0.97
R8060:Larp1b UTSW 3 40985402 missense
R8282:Larp1b UTSW 3 41036810 missense probably damaging 0.99
R8429:Larp1b UTSW 3 40977227 makesense probably null
R8458:Larp1b UTSW 3 40976560 missense probably benign 0.00
X0021:Larp1b UTSW 3 40967494 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCCCACTCCCCAGGATTT -3'
(R):5'- GATCGGCCAGAAGACCAAAC -3'

Sequencing Primer
(F):5'- CCAGGATTTTTACTTTGGGCAAC -3'
(R):5'- CATGCCAAATCAAATCAGAGGAG -3'
Posted On2015-02-05