Mutagenetix > Incidental Mutations

Incidental Mutation 'R3054:Slc4a4'

265064

Institutional Source

Beutler Lab

Gene Symbol

Slc4a4

Ensembl Gene

ENSMUSG00000060961

Gene Name

solute carrier family 4 (anion exchanger), member 4

Synonyms

NBC1, NBC

MMRRC Submission

040563-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3054 (G1)

Quality Score

212

Status

Not validated

Chromosome

Chromosomal Location

88886818-89239653 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 89225948 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 971 (V971A)

Ref Sequence

ENSEMBL: ENSMUSP00000121744 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113218] [ENSMUST00000130041] [ENSMUST00000148750] [ENSMUST00000156238]

Predicted Effect

probably damaging
Transcript: ENSMUST00000113218
AA Change: V962A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000108844
Gene: ENSMUSG00000060961
AA Change: V962A

Domain	Start	End	E-Value	Type
low complexity region	40	59	N/A	INTRINSIC
low complexity region	76	87	N/A	INTRINSIC
Pfam:Band_3_cyto	137	379	1.1e-100	PFAM
low complexity region	408	423	N/A	INTRINSIC
Pfam:HCO3_cotransp	426	947	3e-246	PFAM
transmembrane domain	953	975	N/A	INTRINSIC
low complexity region	999	1015	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000130041
AA Change: V927A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000118413
Gene: ENSMUSG00000060961
AA Change: V927A

Domain	Start	End	E-Value	Type
Pfam:Band_3_cyto	93	344	1.5e-101	PFAM
low complexity region	373	388	N/A	INTRINSIC
Pfam:HCO3_cotransp	391	912	2.7e-246	PFAM
transmembrane domain	918	940	N/A	INTRINSIC
low complexity region	964	980	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000148750
AA Change: V971A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000119325
Gene: ENSMUSG00000060961
AA Change: V971A

Domain	Start	End	E-Value	Type
low complexity region	40	59	N/A	INTRINSIC
low complexity region	76	87	N/A	INTRINSIC
Pfam:Band_3_cyto	137	388	3.7e-101	PFAM
low complexity region	417	432	N/A	INTRINSIC
Pfam:HCO3_cotransp	435	956	7.3e-246	PFAM
transmembrane domain	962	984	N/A	INTRINSIC
low complexity region	1008	1024	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000156238
AA Change: V971A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000121744
Gene: ENSMUSG00000060961
AA Change: V971A

Domain	Start	End	E-Value	Type
low complexity region	40	59	N/A	INTRINSIC
low complexity region	76	87	N/A	INTRINSIC
Pfam:Band_3_cyto	137	388	4.6e-101	PFAM
low complexity region	417	432	N/A	INTRINSIC
Pfam:HCO3_cotransp	436	956	4.1e-231	PFAM
transmembrane domain	962	984	N/A	INTRINSIC
low complexity region	1008	1024	N/A	INTRINSIC

Meta Mutation Damage Score

0.0974

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium bicarbonate cotransporter (NBC) involved in the regulation of bicarbonate secretion and absorption and intracellular pH. Mutations in this gene are associated with proximal renal tubular acidosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit smaller birth size, growth retardation, postnatal lethality, bowel obstructions, altered blood chemistry, acidosis, spleen defects and defects in ion homeostasis. Heterozygotes have decreased levels of circulating bicarbonate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730596B20Rik	A	T	6: 52,179,128		probably benign	Het
Aldh1l2	T	C	10: 83,502,472	K528E	probably benign	Het
Als2	A	G	1: 59,215,494	C235R	probably damaging	Het
Armc6	C	A	8: 70,225,149	V177L	probably benign	Het
Asb7	A	T	7: 66,679,211	V27D	probably damaging	Het
Bard1	A	G	1: 71,088,231	V73A	possibly damaging	Het
Ccdc150	A	G	1: 54,288,842	N361S	possibly damaging	Het
Cntn5	A	G	9: 10,419,071	L7P	probably benign	Het
Cst3	A	G	2: 148,872,031	S118P	probably damaging	Het
Cyp2a22	T	C	7: 26,938,829	D84G	probably damaging	Het
D330045A20Rik	T	A	X: 139,511,557	V439E	possibly damaging	Het
Ddo	A	G	10: 40,631,742	N45S	probably benign	Het
Drd4	T	C	7: 141,294,479	V319A	probably damaging	Het
Fat3	C	T	9: 15,960,496	R3533H	probably benign	Het
Fras1	A	T	5: 96,764,943	I3369F	probably damaging	Het
Gm5591	T	C	7: 38,520,634	S272G	probably benign	Het
Gm8444	A	T	15: 81,843,644		probably benign	Het
Gm9776	A	G	13: 94,358,650		probably benign	Het
Kdm1b	C	T	13: 47,063,077	R308W	probably damaging	Het
Larp1b	A	T	3: 40,964,100	I59F	probably benign	Het
Ltn1	C	T	16: 87,404,073	A1092T	probably benign	Het
Map1b	A	G	13: 99,432,742	V1157A	unknown	Het
Mboat1	A	T	13: 30,195,741	M92L	probably benign	Het
Meis3	G	T	7: 16,182,453	L284F	probably damaging	Het
Muc20	T	C	16: 32,779,029	F3317L	probably benign	Het
Muc5b	G	T	7: 141,864,041	V3575F	probably damaging	Het
Polr1e	C	T	4: 45,018,724	T18I	possibly damaging	Het
Ppp4r1	G	T	17: 65,836,079	A764S	probably damaging	Het
Psg29	A	G	7: 17,208,802	T243A	probably benign	Het
Ptprn2	T	C	12: 116,722,133	Y71H	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sh3bp1	C	T	15: 78,911,422	P584S	probably benign	Het
Stil	T	A	4: 115,004,966	H35Q	probably damaging	Het
Strn	A	T	17: 78,682,892	V65D	probably damaging	Het
Sumf1	T	C	6: 108,153,204	N185D	probably benign	Het
Timm29	T	C	9: 21,593,591	M185T	probably damaging	Het
Tjp3	T	C	10: 81,280,507	K251R	probably benign	Het
Tubgcp6	A	T	15: 89,122,603	M72K	probably damaging	Het
Utp14b	T	A	1: 78,664,725	D113E	possibly damaging	Het
Vps13b	A	G	15: 35,646,361	E1537G	probably damaging	Het
Zfr	A	G	15: 12,154,507	N592S	probably damaging	Het

Other mutations in Slc4a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00827:Slc4a4	APN	5	89179686	missense	probably benign	0.01
IGL00976:Slc4a4	APN	5	88954798	missense	probably damaging	1.00
IGL01074:Slc4a4	APN	5	89179774	missense	probably damaging	1.00
IGL01120:Slc4a4	APN	5	89132379	missense	probably damaging	1.00
IGL01284:Slc4a4	APN	5	89129673	missense	probably benign	0.22
IGL01375:Slc4a4	APN	5	89179734	missense	probably damaging	1.00
IGL01399:Slc4a4	APN	5	89228935	missense	probably damaging	1.00
IGL01487:Slc4a4	APN	5	89228856	missense	probably benign	0.19
IGL02501:Slc4a4	APN	5	89129649	missense	probably benign	0.13
IGL03104:Slc4a4	APN	5	89149372	missense	probably damaging	1.00
IGL03157:Slc4a4	APN	5	89156513	missense	probably damaging	0.99
IGL03205:Slc4a4	APN	5	89149330	missense	probably benign	0.00
IGL03356:Slc4a4	APN	5	89122483	missense	probably benign	0.00
IGL03372:Slc4a4	APN	5	89156426	missense	probably damaging	1.00
IGL03382:Slc4a4	APN	5	89228836	missense	probably damaging	1.00
camera	UTSW	5	89132507	missense	probably damaging	1.00
pixels	UTSW	5	89122403	missense	probably damaging	0.99
Shutter	UTSW	5	89225948	missense	probably damaging	1.00
Tetrapod	UTSW	5	89228972	missense	probably damaging	1.00
Therapod	UTSW	5	89135722	missense	probably damaging	1.00
tripod	UTSW	5	89149333	missense	possibly damaging	0.52
BB008:Slc4a4	UTSW	5	89170781	missense	probably benign	0.00
BB018:Slc4a4	UTSW	5	89170781	missense	probably benign	0.00
PIT4515001:Slc4a4	UTSW	5	89133253	missense	probably damaging	1.00
PIT4544001:Slc4a4	UTSW	5	89038543	missense	probably damaging	1.00
R0007:Slc4a4	UTSW	5	89038578	missense	probably damaging	1.00
R0052:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0052:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0054:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0055:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0230:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0234:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0234:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0632:Slc4a4	UTSW	5	89129641	missense	probably damaging	1.00
R1199:Slc4a4	UTSW	5	89215794	critical splice donor site	probably null
R1597:Slc4a4	UTSW	5	89135728	missense	probably benign	0.01
R1783:Slc4a4	UTSW	5	89132414	missense	probably damaging	1.00
R1813:Slc4a4	UTSW	5	89046308	missense	probably damaging	0.98
R1896:Slc4a4	UTSW	5	89046308	missense	probably damaging	0.98
R2000:Slc4a4	UTSW	5	89028347	missense	probably damaging	1.00
R2139:Slc4a4	UTSW	5	89046264	missense	probably damaging	1.00
R2163:Slc4a4	UTSW	5	89214576	missense	probably damaging	1.00
R2513:Slc4a4	UTSW	5	89156398	missense	probably benign	0.00
R2873:Slc4a4	UTSW	5	89135764	missense	probably damaging	1.00
R2995:Slc4a4	UTSW	5	88934814	missense	probably damaging	1.00
R3055:Slc4a4	UTSW	5	89132507	missense	probably damaging	1.00
R3055:Slc4a4	UTSW	5	89225948	missense	probably damaging	1.00
R3056:Slc4a4	UTSW	5	89225948	missense	probably damaging	1.00
R3617:Slc4a4	UTSW	5	89234804	missense	probably benign	0.00
R3856:Slc4a4	UTSW	5	89232839	missense	probably benign	0.00
R3863:Slc4a4	UTSW	5	89135648	missense	possibly damaging	0.95
R3896:Slc4a4	UTSW	5	89197766	splice site	probably benign
R4007:Slc4a4	UTSW	5	89214593	missense	probably damaging	1.00
R4616:Slc4a4	UTSW	5	89038561	missense	probably damaging	1.00
R4740:Slc4a4	UTSW	5	89225894	missense	probably damaging	1.00
R5009:Slc4a4	UTSW	5	89149298	critical splice acceptor site	probably null
R5119:Slc4a4	UTSW	5	88954862	missense	probably null	0.97
R5228:Slc4a4	UTSW	5	89156525	missense	possibly damaging	0.50
R5394:Slc4a4	UTSW	5	89197764	critical splice donor site	probably null
R5396:Slc4a4	UTSW	5	89046217	missense	probably benign	0.00
R5662:Slc4a4	UTSW	5	89028244	missense	probably damaging	0.96
R5664:Slc4a4	UTSW	5	89028244	missense	probably damaging	0.96
R6021:Slc4a4	UTSW	5	89040402	intron	probably benign
R6088:Slc4a4	UTSW	5	89197704	missense	probably benign	0.12
R6337:Slc4a4	UTSW	5	89046372	missense	probably benign	0.21
R6416:Slc4a4	UTSW	5	89179729	missense	probably benign	0.26
R6452:Slc4a4	UTSW	5	89228980	missense	probably benign	0.05
R6524:Slc4a4	UTSW	5	89232764	missense	probably benign	0.01
R6566:Slc4a4	UTSW	5	89149333	missense	possibly damaging	0.52
R6727:Slc4a4	UTSW	5	89170765	missense	probably benign	0.00
R6844:Slc4a4	UTSW	5	89228972	missense	probably damaging	1.00
R6970:Slc4a4	UTSW	5	89179831	missense	probably damaging	0.98
R7021:Slc4a4	UTSW	5	89040346	splice site	probably null
R7180:Slc4a4	UTSW	5	89046236	missense	probably damaging	0.97
R7197:Slc4a4	UTSW	5	88934574	intron	probably benign
R7246:Slc4a4	UTSW	5	89122403	missense	probably damaging	0.99
R7309:Slc4a4	UTSW	5	89170751	missense	probably benign
R7412:Slc4a4	UTSW	5	89214647	splice site	probably null
R7492:Slc4a4	UTSW	5	89129650	missense	possibly damaging	0.92
R7561:Slc4a4	UTSW	5	89199697	missense	probably damaging	1.00
R7577:Slc4a4	UTSW	5	89225867	missense	probably damaging	0.97
R7609:Slc4a4	UTSW	5	89135686	missense	probably damaging	1.00
R7781:Slc4a4	UTSW	5	89228932	missense	possibly damaging	0.78
R7931:Slc4a4	UTSW	5	89170781	missense	probably benign	0.00
R7950:Slc4a4	UTSW	5	89058278	splice site	probably null
R8078:Slc4a4	UTSW	5	89179707	missense	probably benign	0.00
R8313:Slc4a4	UTSW	5	89046263	missense	possibly damaging	0.84
R8332:Slc4a4	UTSW	5	89179821	missense	probably benign	0.11
R8534:Slc4a4	UTSW	5	89135722	missense	probably damaging	1.00
R8735:Slc4a4	UTSW	5	89132442	missense	probably damaging	1.00
R8786:Slc4a4	UTSW	5	89084690	missense	probably benign	0.07
Z1177:Slc4a4	UTSW	5	89132459	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATCACTCCTGGCTGGCTAAG -3'
(R):5'- GGAACCTGTGCCAGTTATTGAAC -3'

Sequencing Primer
(F):5'- AGATAACACATCGACTTTTTCTCC -3'
(R):5'- CCTGTGCCAGTTATTGAACTCAAGTG -3'

Posted On

2015-02-05