Incidental Mutation 'R3054:5730596B20Rik'
ID265067
Institutional Source Beutler Lab
Gene Symbol 5730596B20Rik
Ensembl Gene ENSMUSG00000056468
Gene NameRIKEN cDNA 5730596B20 gene
Synonyms
MMRRC Submission 040563-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R3054 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location52177498-52180851 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 52179128 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070587] [ENSMUST00000114434] [ENSMUST00000128102] [ENSMUST00000134831]
Predicted Effect unknown
Transcript: ENSMUST00000070587
AA Change: D58V
SMART Domains Protein: ENSMUSP00000069583
Gene: ENSMUSG00000056468
AA Change: D58V

DomainStartEndE-ValueType
low complexity region 64 79 N/A INTRINSIC
low complexity region 96 113 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114434
SMART Domains Protein: ENSMUSP00000110077
Gene: ENSMUSG00000079560

DomainStartEndE-ValueType
low complexity region 76 131 N/A INTRINSIC
HOX 192 254 3.35e-28 SMART
low complexity region 287 302 N/A INTRINSIC
low complexity region 304 326 N/A INTRINSIC
Pfam:DUF4074 377 441 9e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128102
Predicted Effect probably benign
Transcript: ENSMUST00000134831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139055
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191326
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191453
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 T C 10: 83,502,472 K528E probably benign Het
Als2 A G 1: 59,215,494 C235R probably damaging Het
Armc6 C A 8: 70,225,149 V177L probably benign Het
Asb7 A T 7: 66,679,211 V27D probably damaging Het
Bard1 A G 1: 71,088,231 V73A possibly damaging Het
Ccdc150 A G 1: 54,288,842 N361S possibly damaging Het
Cntn5 A G 9: 10,419,071 L7P probably benign Het
Cst3 A G 2: 148,872,031 S118P probably damaging Het
Cyp2a22 T C 7: 26,938,829 D84G probably damaging Het
D330045A20Rik T A X: 139,511,557 V439E possibly damaging Het
Ddo A G 10: 40,631,742 N45S probably benign Het
Drd4 T C 7: 141,294,479 V319A probably damaging Het
Fat3 C T 9: 15,960,496 R3533H probably benign Het
Fras1 A T 5: 96,764,943 I3369F probably damaging Het
Gm5591 T C 7: 38,520,634 S272G probably benign Het
Gm8444 A T 15: 81,843,644 probably benign Het
Gm9776 A G 13: 94,358,650 probably benign Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Larp1b A T 3: 40,964,100 I59F probably benign Het
Ltn1 C T 16: 87,404,073 A1092T probably benign Het
Map1b A G 13: 99,432,742 V1157A unknown Het
Mboat1 A T 13: 30,195,741 M92L probably benign Het
Meis3 G T 7: 16,182,453 L284F probably damaging Het
Muc20 T C 16: 32,779,029 F3317L probably benign Het
Muc5b G T 7: 141,864,041 V3575F probably damaging Het
Polr1e C T 4: 45,018,724 T18I possibly damaging Het
Ppp4r1 G T 17: 65,836,079 A764S probably damaging Het
Psg29 A G 7: 17,208,802 T243A probably benign Het
Ptprn2 T C 12: 116,722,133 Y71H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sh3bp1 C T 15: 78,911,422 P584S probably benign Het
Slc4a4 T C 5: 89,225,948 V971A probably damaging Het
Stil T A 4: 115,004,966 H35Q probably damaging Het
Strn A T 17: 78,682,892 V65D probably damaging Het
Sumf1 T C 6: 108,153,204 N185D probably benign Het
Timm29 T C 9: 21,593,591 M185T probably damaging Het
Tjp3 T C 10: 81,280,507 K251R probably benign Het
Tubgcp6 A T 15: 89,122,603 M72K probably damaging Het
Utp14b T A 1: 78,664,725 D113E possibly damaging Het
Vps13b A G 15: 35,646,361 E1537G probably damaging Het
Zfr A G 15: 12,154,507 N592S probably damaging Het
Other mutations in 5730596B20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4576001:5730596B20Rik UTSW 6 52179469 missense unknown
R0279:5730596B20Rik UTSW 6 52179202 intron probably benign
R1344:5730596B20Rik UTSW 6 52179151 intron probably benign
R1418:5730596B20Rik UTSW 6 52179151 intron probably benign
R2073:5730596B20Rik UTSW 6 52178982 nonsense probably null
R3055:5730596B20Rik UTSW 6 52179128 intron probably benign
R4235:5730596B20Rik UTSW 6 52178961 intron probably benign
R4369:5730596B20Rik UTSW 6 52179062 intron probably benign
R6057:5730596B20Rik UTSW 6 52179520 intron probably benign
R7082:5730596B20Rik UTSW 6 52179280 missense unknown
R7476:5730596B20Rik UTSW 6 52179034 missense unknown
R7819:5730596B20Rik UTSW 6 52179274 intron probably benign
R8247:5730596B20Rik UTSW 6 52178962 missense unknown
Predicted Primers PCR Primer
(F):5'- ACAGGCAATAGCTCCCTTTC -3'
(R):5'- ATGATGCTTCCAGCCACTTTG -3'

Sequencing Primer
(F):5'- AGCCAGAGAAATGTTGTCTCTGC -3'
(R):5'- GAGGGCATGCCATTGTTT -3'
Posted On2015-02-05