Incidental Mutation 'R3054:Sumf1'
ID265068
Institutional Source Beutler Lab
Gene Symbol Sumf1
Ensembl Gene ENSMUSG00000030101
Gene Namesulfatase modifying factor 1
Synonyms
MMRRC Submission 040563-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R3054 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location108107028-108185582 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108153204 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 185 (N185D)
Ref Sequence ENSEMBL: ENSMUSP00000127537 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032191] [ENSMUST00000167338] [ENSMUST00000172188]
Predicted Effect probably benign
Transcript: ENSMUST00000032191
AA Change: N210D

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000032191
Gene: ENSMUSG00000030101
AA Change: N210D

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
Pfam:FGE-sulfatase 85 365 1.4e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167338
AA Change: N185D

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000127537
Gene: ENSMUSG00000030101
AA Change: N185D

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
Pfam:FGE-sulfatase 85 340 1.2e-93 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171697
Predicted Effect probably benign
Transcript: ENSMUST00000172188
SMART Domains Protein: ENSMUSP00000132321
Gene: ENSMUSG00000030101

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
Pfam:FGE-sulfatase 85 149 9.5e-18 PFAM
Pfam:FGE-sulfatase 144 233 4.9e-30 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the hydrolysis of sulfate esters by oxidizing a cysteine residue in the substrate sulfatase to an active site 3-oxoalanine residue, which is also known as C-alpha-formylglycine. Mutations in this gene cause multiple sulfatase deficiency, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes lacking all sulfatase activities exhibit frequent early postnatal lethality and growth retardation, skeletal anomalies, neurological defects, and massive GAG accumulation and cell vacuolization in all tissues in association with systemic inflammation, apoptosis, and neurodegeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik A T 6: 52,179,128 probably benign Het
Aldh1l2 T C 10: 83,502,472 K528E probably benign Het
Als2 A G 1: 59,215,494 C235R probably damaging Het
Armc6 C A 8: 70,225,149 V177L probably benign Het
Asb7 A T 7: 66,679,211 V27D probably damaging Het
Bard1 A G 1: 71,088,231 V73A possibly damaging Het
Ccdc150 A G 1: 54,288,842 N361S possibly damaging Het
Cntn5 A G 9: 10,419,071 L7P probably benign Het
Cst3 A G 2: 148,872,031 S118P probably damaging Het
Cyp2a22 T C 7: 26,938,829 D84G probably damaging Het
D330045A20Rik T A X: 139,511,557 V439E possibly damaging Het
Ddo A G 10: 40,631,742 N45S probably benign Het
Drd4 T C 7: 141,294,479 V319A probably damaging Het
Fat3 C T 9: 15,960,496 R3533H probably benign Het
Fras1 A T 5: 96,764,943 I3369F probably damaging Het
Gm5591 T C 7: 38,520,634 S272G probably benign Het
Gm8444 A T 15: 81,843,644 probably benign Het
Gm9776 A G 13: 94,358,650 probably benign Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Larp1b A T 3: 40,964,100 I59F probably benign Het
Ltn1 C T 16: 87,404,073 A1092T probably benign Het
Map1b A G 13: 99,432,742 V1157A unknown Het
Mboat1 A T 13: 30,195,741 M92L probably benign Het
Meis3 G T 7: 16,182,453 L284F probably damaging Het
Muc20 T C 16: 32,779,029 F3317L probably benign Het
Muc5b G T 7: 141,864,041 V3575F probably damaging Het
Polr1e C T 4: 45,018,724 T18I possibly damaging Het
Ppp4r1 G T 17: 65,836,079 A764S probably damaging Het
Psg29 A G 7: 17,208,802 T243A probably benign Het
Ptprn2 T C 12: 116,722,133 Y71H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sh3bp1 C T 15: 78,911,422 P584S probably benign Het
Slc4a4 T C 5: 89,225,948 V971A probably damaging Het
Stil T A 4: 115,004,966 H35Q probably damaging Het
Strn A T 17: 78,682,892 V65D probably damaging Het
Timm29 T C 9: 21,593,591 M185T probably damaging Het
Tjp3 T C 10: 81,280,507 K251R probably benign Het
Tubgcp6 A T 15: 89,122,603 M72K probably damaging Het
Utp14b T A 1: 78,664,725 D113E possibly damaging Het
Vps13b A G 15: 35,646,361 E1537G probably damaging Het
Zfr A G 15: 12,154,507 N592S probably damaging Het
Other mutations in Sumf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01112:Sumf1 APN 6 108176016 missense probably damaging 1.00
IGL01624:Sumf1 APN 6 108153201 missense probably damaging 1.00
IGL02146:Sumf1 APN 6 108173431 critical splice acceptor site probably null
R0594:Sumf1 UTSW 6 108173414 missense probably benign 0.31
R0633:Sumf1 UTSW 6 108144671 missense probably damaging 1.00
R1479:Sumf1 UTSW 6 108176058 missense probably damaging 1.00
R3036:Sumf1 UTSW 6 108153191 missense possibly damaging 0.92
R4246:Sumf1 UTSW 6 108155013 missense probably damaging 1.00
R4247:Sumf1 UTSW 6 108155013 missense probably damaging 1.00
R4249:Sumf1 UTSW 6 108155013 missense probably damaging 1.00
R4574:Sumf1 UTSW 6 108108432 unclassified probably benign
R4853:Sumf1 UTSW 6 108185495 missense probably benign 0.00
R5146:Sumf1 UTSW 6 108185310 missense probably benign 0.12
R5764:Sumf1 UTSW 6 108118463 intron probably benign
R7981:Sumf1 UTSW 6 108152225 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTCCTGACCACAGCAAGTTC -3'
(R):5'- GAGAGGCTGTGACCCATTTG -3'

Sequencing Primer
(F):5'- TGACCACAGCAAGTTCCAGGG -3'
(R):5'- TGGGCATCTAAAACTTCAGAAGTCC -3'
Posted On2015-02-05