Incidental Mutation 'R3054:Meis3'
ID265069
Institutional Source Beutler Lab
Gene Symbol Meis3
Ensembl Gene ENSMUSG00000041420
Gene NameMeis homeobox 3
SynonymsMrg2
MMRRC Submission 040563-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R3054 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location16175090-16186504 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 16182453 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 284 (L284F)
Ref Sequence ENSEMBL: ENSMUSP00000135103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002495] [ENSMUST00000176342] [ENSMUST00000176446] [ENSMUST00000176506] [ENSMUST00000177156] [ENSMUST00000177540]
Predicted Effect probably damaging
Transcript: ENSMUST00000002495
AA Change: L284F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000002495
Gene: ENSMUSG00000041420
AA Change: L284F

DomainStartEndE-ValueType
low complexity region 88 101 N/A INTRINSIC
low complexity region 230 244 N/A INTRINSIC
HOX 265 330 9.15e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175946
Predicted Effect probably damaging
Transcript: ENSMUST00000176083
AA Change: L284F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135196
Gene: ENSMUSG00000041420
AA Change: L284F

DomainStartEndE-ValueType
Pfam:Meis_PKNOX_N 99 183 6.5e-47 PFAM
low complexity region 230 244 N/A INTRINSIC
HOX 265 330 9.15e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176342
SMART Domains Protein: ENSMUSP00000135302
Gene: ENSMUSG00000041420

DomainStartEndE-ValueType
low complexity region 88 101 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176446
Predicted Effect probably damaging
Transcript: ENSMUST00000176506
AA Change: L267F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134918
Gene: ENSMUSG00000041420
AA Change: L267F

DomainStartEndE-ValueType
low complexity region 88 101 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
HOX 248 313 9.15e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176714
Predicted Effect probably damaging
Transcript: ENSMUST00000177156
AA Change: L284F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135103
Gene: ENSMUSG00000041420
AA Change: L284F

DomainStartEndE-ValueType
low complexity region 88 101 N/A INTRINSIC
low complexity region 230 244 N/A INTRINSIC
Pfam:Homeobox_KN 283 313 2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177540
SMART Domains Protein: ENSMUSP00000135388
Gene: ENSMUSG00000041420

DomainStartEndE-ValueType
low complexity region 88 101 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183527
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoding this gene belongs to the three amino acid loop extension family of homeodomain transcription factors, which play essential roles in many embryonic processes. These proteins are characterized by an atypical homeodomain containing a three amino acid loop extension between helices 1 and 2. Expression of this gene begins during the compaction stage of embryogenesis and continues into the blastocyst stage. This gene is also expressed in pancreatic islet cells and beta-cells and regulates beta-cell survival. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik A T 6: 52,179,128 probably benign Het
Aldh1l2 T C 10: 83,502,472 K528E probably benign Het
Als2 A G 1: 59,215,494 C235R probably damaging Het
Armc6 C A 8: 70,225,149 V177L probably benign Het
Asb7 A T 7: 66,679,211 V27D probably damaging Het
Bard1 A G 1: 71,088,231 V73A possibly damaging Het
Ccdc150 A G 1: 54,288,842 N361S possibly damaging Het
Cntn5 A G 9: 10,419,071 L7P probably benign Het
Cst3 A G 2: 148,872,031 S118P probably damaging Het
Cyp2a22 T C 7: 26,938,829 D84G probably damaging Het
D330045A20Rik T A X: 139,511,557 V439E possibly damaging Het
Ddo A G 10: 40,631,742 N45S probably benign Het
Drd4 T C 7: 141,294,479 V319A probably damaging Het
Fat3 C T 9: 15,960,496 R3533H probably benign Het
Fras1 A T 5: 96,764,943 I3369F probably damaging Het
Gm5591 T C 7: 38,520,634 S272G probably benign Het
Gm8444 A T 15: 81,843,644 probably benign Het
Gm9776 A G 13: 94,358,650 probably benign Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Larp1b A T 3: 40,964,100 I59F probably benign Het
Ltn1 C T 16: 87,404,073 A1092T probably benign Het
Map1b A G 13: 99,432,742 V1157A unknown Het
Mboat1 A T 13: 30,195,741 M92L probably benign Het
Muc20 T C 16: 32,779,029 F3317L probably benign Het
Muc5b G T 7: 141,864,041 V3575F probably damaging Het
Polr1e C T 4: 45,018,724 T18I possibly damaging Het
Ppp4r1 G T 17: 65,836,079 A764S probably damaging Het
Psg29 A G 7: 17,208,802 T243A probably benign Het
Ptprn2 T C 12: 116,722,133 Y71H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sh3bp1 C T 15: 78,911,422 P584S probably benign Het
Slc4a4 T C 5: 89,225,948 V971A probably damaging Het
Stil T A 4: 115,004,966 H35Q probably damaging Het
Strn A T 17: 78,682,892 V65D probably damaging Het
Sumf1 T C 6: 108,153,204 N185D probably benign Het
Timm29 T C 9: 21,593,591 M185T probably damaging Het
Tjp3 T C 10: 81,280,507 K251R probably benign Het
Tubgcp6 A T 15: 89,122,603 M72K probably damaging Het
Utp14b T A 1: 78,664,725 D113E possibly damaging Het
Vps13b A G 15: 35,646,361 E1537G probably damaging Het
Zfr A G 15: 12,154,507 N592S probably damaging Het
Other mutations in Meis3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Meis3 APN 7 16178947 critical splice acceptor site probably benign 0.00
IGL02508:Meis3 APN 7 16178797 splice site probably null
IGL03125:Meis3 APN 7 16178770 missense probably damaging 1.00
IGL03383:Meis3 APN 7 16183819 missense probably damaging 1.00
R0032:Meis3 UTSW 7 16182285 unclassified probably benign
R1147:Meis3 UTSW 7 16183776 unclassified probably benign
R1471:Meis3 UTSW 7 16177571 nonsense probably null
R3927:Meis3 UTSW 7 16177494 missense probably benign 0.06
R5314:Meis3 UTSW 7 16184064 missense probably damaging 0.99
R6713:Meis3 UTSW 7 16182330 nonsense probably null
R6847:Meis3 UTSW 7 16183864 missense probably damaging 1.00
R7218:Meis3 UTSW 7 16184701 missense probably benign
R7517:Meis3 UTSW 7 16177818 missense probably damaging 1.00
R7540:Meis3 UTSW 7 16177493 nonsense probably null
R7699:Meis3 UTSW 7 16177556 missense probably benign
R7700:Meis3 UTSW 7 16177556 missense probably benign
R7790:Meis3 UTSW 7 16182397 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- AGCACCAACTGGACATGTC -3'
(R):5'- TCTGGGCCTTGTCTTCACAG -3'

Sequencing Primer
(F):5'- AACTGGACATGTCTCCCCCTG -3'
(R):5'- TATCCTGGGACAAGTGGCATG -3'
Posted On2015-02-05