Incidental Mutation 'I1329:Erbb3'
ID26507
Institutional Source Beutler Lab
Gene Symbol Erbb3
Ensembl Gene ENSMUSG00000018166
Gene Nameerb-b2 receptor tyrosine kinase 3
SynonymsErbb-3, Erbb3r, HER3
Accession Numbers

Ncbi RefSeq: NM_010153.1; MGI:95411

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #I1329 (G1) of strain toku
Quality Score222
Status Validated (trace)
Chromosome10
Chromosomal Location128567523-128589652 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128583454 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 215 (N215S)
Ref Sequence ENSEMBL: ENSMUSP00000080716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082059]
Predicted Effect possibly damaging
Transcript: ENSMUST00000082059
AA Change: N215S

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000080716
Gene: ENSMUSG00000018166
AA Change: N215S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 2.4e-31 PFAM
FU 180 220 5.83e0 SMART
FU 223 265 7.63e-10 SMART
Pfam:Recep_L_domain 353 474 7.5e-33 PFAM
FU 490 541 7.82e-7 SMART
FU 546 595 1.34e-5 SMART
FU 607 643 9.24e0 SMART
TyrKc 707 963 7.42e-91 SMART
low complexity region 997 1018 N/A INTRINSIC
low complexity region 1113 1124 N/A INTRINSIC
low complexity region 1135 1148 N/A INTRINSIC
low complexity region 1172 1185 N/A INTRINSIC
low complexity region 1186 1196 N/A INTRINSIC
low complexity region 1201 1213 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184111
Meta Mutation Damage Score 0.0722 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 95.2%
Validation Efficiency 89% (42/47)
MGI Phenotype Strain: 3513098; 1929072; 1928828; 1929598
Lethality: E10-E14
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the epidermal growth factor receptor (EGFR) family of receptor tyrosine kinases. This membrane-bound protein has a neuregulin binding domain but not an active kinase domain. It therefore can bind this ligand but not convey the signal into the cell through protein phosphorylation. However, it does form heterodimers with other EGF receptor family members which do have kinase activity. Heterodimerization leads to the activation of pathways which lead to cell proliferation or differentiation. Amplification of this gene and/or overexpression of its protein have been reported in numerous cancers, including prostate, bladder, and breast tumors. Alternate transcriptional splice variants encoding different isoforms have been characterized. One isoform lacks the intermembrane region and is secreted outside the cell. This form acts to modulate the activity of the membrane-bound form. Additional splice variants have also been reported, but they have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a lack of Schwann-cell precursors leading to loss of sensory and motor neurons, hypoplasia of the primary sympathetic ganglion chain, cardiac defects, impaired brain development, and embryonic lethality. [provided by MGI curators]
Allele List at MGI

All alleles(27) : Targeted(11) Gene trapped(14) Chemically induced(2)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,245,194 S542P probably benign Het
Adamts13 T C 2: 26,973,619 I28T possibly damaging Het
Agbl4 T A 4: 110,478,455 probably benign Het
Aspscr1 G C 11: 120,701,240 V268L probably damaging Het
Btbd10 A G 7: 113,332,875 S115P probably benign Het
Cercam T A 2: 29,871,085 V132E probably damaging Het
Decr1 G A 4: 15,930,976 R119* probably null Het
Dlst T C 12: 85,123,841 M248T probably damaging Het
Flnc G A 6: 29,451,415 V1543M probably damaging Het
Gk5 GCC GC 9: 96,140,629 probably null Het
Glrb T A 3: 80,862,074 R115S probably damaging Het
Gm5592 T A 7: 41,286,354 Y93* probably null Het
Gpr20 C T 15: 73,695,763 R259H probably damaging Het
Il1rap A G 16: 26,692,850 T215A probably benign Het
Ipmk T C 10: 71,381,447 C275R possibly damaging Het
Lats1 A G 10: 7,712,802 N1061S probably benign Het
Nkain3 A G 4: 20,158,329 probably benign Het
Nr1h4 A G 10: 89,483,362 probably benign Het
Nr4a3 A G 4: 48,051,585 Q142R probably benign Het
Otog G A 7: 46,246,503 V131I probably benign Het
Parp12 A T 6: 39,087,571 M627K probably damaging Het
Pcdh9 A G 14: 93,886,209 S842P probably benign Het
Phc2 G C 4: 128,711,113 G214A probably damaging Het
Prpf40a C A 2: 53,176,395 V92L probably benign Het
Qser1 A T 2: 104,786,977 Y1163* probably null Het
Rpe65 A G 3: 159,624,723 D509G probably benign Het
Scin T A 12: 40,073,330 N518I probably damaging Het
Sfswap G T 5: 129,507,137 probably benign Het
Tfpi A T 2: 84,444,116 N182K possibly damaging Het
Tph1 A G 7: 46,650,013 L368P probably damaging Het
Ttn T C 2: 76,741,572 T26326A possibly damaging Het
Ubr1 G A 2: 120,934,294 probably benign Het
Usf3 G T 16: 44,220,530 C1791F probably damaging Het
Vmn1r16 T G 6: 57,323,534 R34S probably damaging Het
Ylpm1 C A 12: 85,040,880 P1604Q probably damaging Het
Zc3h12a A G 4: 125,119,364 V569A possibly damaging Het
Zmynd8 A G 2: 165,828,225 F488S probably damaging Het
Other mutations in Erbb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Erbb3 APN 10 128570983 missense probably damaging 0.99
IGL01482:Erbb3 APN 10 128572929 missense possibly damaging 0.87
IGL01866:Erbb3 APN 10 128569368 makesense probably null
IGL01981:Erbb3 APN 10 128571650 missense probably benign 0.28
IGL02190:Erbb3 APN 10 128571010 splice site probably null
IGL02329:Erbb3 APN 10 128573219 missense probably damaging 1.00
IGL02400:Erbb3 APN 10 128579524 missense probably benign 0.02
IGL02478:Erbb3 APN 10 128571358 nonsense probably null
IGL02502:Erbb3 APN 10 128570284 missense probably benign
IGL02539:Erbb3 APN 10 128584305 splice site probably null
IGL03187:Erbb3 APN 10 128572594 splice site probably benign
PIT4812001:Erbb3 UTSW 10 128574379 missense possibly damaging 0.67
R0006:Erbb3 UTSW 10 128573410 critical splice donor site probably null
R0006:Erbb3 UTSW 10 128573410 critical splice donor site probably null
R0078:Erbb3 UTSW 10 128583441 missense probably damaging 1.00
R0366:Erbb3 UTSW 10 128572570 missense possibly damaging 0.77
R0601:Erbb3 UTSW 10 128577012 missense probably benign 0.01
R0621:Erbb3 UTSW 10 128586225 missense probably benign 0.00
R1222:Erbb3 UTSW 10 128571665 missense probably damaging 1.00
R1675:Erbb3 UTSW 10 128571204 missense probably damaging 0.97
R1676:Erbb3 UTSW 10 128583248 missense probably benign 0.08
R1692:Erbb3 UTSW 10 128571725 missense probably benign 0.19
R1875:Erbb3 UTSW 10 128574466 missense possibly damaging 0.71
R2002:Erbb3 UTSW 10 128586225 missense probably benign 0.00
R2219:Erbb3 UTSW 10 128569871 missense probably damaging 0.99
R2328:Erbb3 UTSW 10 128583693 missense probably damaging 1.00
R3840:Erbb3 UTSW 10 128570324 missense probably benign
R4393:Erbb3 UTSW 10 128572770 missense probably damaging 1.00
R4567:Erbb3 UTSW 10 128579075 missense probably damaging 1.00
R4616:Erbb3 UTSW 10 128572770 nonsense probably null
R4766:Erbb3 UTSW 10 128586238 missense possibly damaging 0.76
R4881:Erbb3 UTSW 10 128576947 missense probably benign 0.00
R4974:Erbb3 UTSW 10 128572448 missense probably benign
R5266:Erbb3 UTSW 10 128569636 missense probably damaging 1.00
R5463:Erbb3 UTSW 10 128570079 nonsense probably null
R5481:Erbb3 UTSW 10 128572480 missense probably damaging 0.98
R5997:Erbb3 UTSW 10 128583185 missense probably damaging 1.00
R6370:Erbb3 UTSW 10 128570074 missense possibly damaging 0.90
R7639:Erbb3 UTSW 10 128569847 missense probably damaging 0.99
R7713:Erbb3 UTSW 10 128574449 missense probably benign
R7847:Erbb3 UTSW 10 128571189 missense probably damaging 1.00
R8529:Erbb3 UTSW 10 128583200 missense probably damaging 0.99
R8843:Erbb3 UTSW 10 128578456 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ACGTTAGCTTGTTGTACACAAGGGG -3'
(R):5'- AAAGTTAGAGCACACGCCGTCC -3'

Sequencing Primer
(F):5'- ACCACTGTCATTGAAGTGTCG -3'
(R):5'- GTCCCATACCCATTACCTATGCAG -3'
Posted On2013-04-16