Incidental Mutation 'R3054:Psg29'
ID265070
Institutional Source Beutler Lab
Gene Symbol Psg29
Ensembl Gene ENSMUSG00000023159
Gene Namepregnancy-specific glycoprotein 29
Synonymscea17
MMRRC Submission 040563-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R3054 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location17203477-17215760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17208802 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 243 (T243A)
Ref Sequence ENSEMBL: ENSMUSP00000075320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075934]
Predicted Effect probably benign
Transcript: ENSMUST00000075934
AA Change: T243A

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000075320
Gene: ENSMUSG00000023159
AA Change: T243A

DomainStartEndE-ValueType
IG 40 137 7.77e-1 SMART
IG 156 257 8.72e-4 SMART
IG 276 377 2.44e0 SMART
IGc2 393 457 3.06e-8 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik A T 6: 52,179,128 probably benign Het
Aldh1l2 T C 10: 83,502,472 K528E probably benign Het
Als2 A G 1: 59,215,494 C235R probably damaging Het
Armc6 C A 8: 70,225,149 V177L probably benign Het
Asb7 A T 7: 66,679,211 V27D probably damaging Het
Bard1 A G 1: 71,088,231 V73A possibly damaging Het
Ccdc150 A G 1: 54,288,842 N361S possibly damaging Het
Cntn5 A G 9: 10,419,071 L7P probably benign Het
Cst3 A G 2: 148,872,031 S118P probably damaging Het
Cyp2a22 T C 7: 26,938,829 D84G probably damaging Het
D330045A20Rik T A X: 139,511,557 V439E possibly damaging Het
Ddo A G 10: 40,631,742 N45S probably benign Het
Drd4 T C 7: 141,294,479 V319A probably damaging Het
Fat3 C T 9: 15,960,496 R3533H probably benign Het
Fras1 A T 5: 96,764,943 I3369F probably damaging Het
Gm5591 T C 7: 38,520,634 S272G probably benign Het
Gm8444 A T 15: 81,843,644 probably benign Het
Gm9776 A G 13: 94,358,650 probably benign Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Larp1b A T 3: 40,964,100 I59F probably benign Het
Ltn1 C T 16: 87,404,073 A1092T probably benign Het
Map1b A G 13: 99,432,742 V1157A unknown Het
Mboat1 A T 13: 30,195,741 M92L probably benign Het
Meis3 G T 7: 16,182,453 L284F probably damaging Het
Muc20 T C 16: 32,779,029 F3317L probably benign Het
Muc5b G T 7: 141,864,041 V3575F probably damaging Het
Polr1e C T 4: 45,018,724 T18I possibly damaging Het
Ppp4r1 G T 17: 65,836,079 A764S probably damaging Het
Ptprn2 T C 12: 116,722,133 Y71H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sh3bp1 C T 15: 78,911,422 P584S probably benign Het
Slc4a4 T C 5: 89,225,948 V971A probably damaging Het
Stil T A 4: 115,004,966 H35Q probably damaging Het
Strn A T 17: 78,682,892 V65D probably damaging Het
Sumf1 T C 6: 108,153,204 N185D probably benign Het
Timm29 T C 9: 21,593,591 M185T probably damaging Het
Tjp3 T C 10: 81,280,507 K251R probably benign Het
Tubgcp6 A T 15: 89,122,603 M72K probably damaging Het
Utp14b T A 1: 78,664,725 D113E possibly damaging Het
Vps13b A G 15: 35,646,361 E1537G probably damaging Het
Zfr A G 15: 12,154,507 N592S probably damaging Het
Other mutations in Psg29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Psg29 APN 7 17208732 missense probably benign 0.42
IGL01107:Psg29 APN 7 17204925 missense probably benign 0.01
IGL01348:Psg29 APN 7 17210673 missense probably benign 0.09
IGL01353:Psg29 APN 7 17205013 missense possibly damaging 0.54
IGL02546:Psg29 APN 7 17208782 missense probably damaging 1.00
IGL02611:Psg29 APN 7 17208791 missense probably benign 0.15
IGL02982:Psg29 APN 7 17211707 missense probably damaging 0.98
IGL03072:Psg29 APN 7 17208794 missense probably benign 0.06
macular UTSW 7 17210535 missense probably benign 0.23
papular UTSW 7 17211912 makesense probably null
R1744:Psg29 UTSW 7 17210353 missense probably damaging 1.00
R2272:Psg29 UTSW 7 17210696 missense probably benign 0.19
R3790:Psg29 UTSW 7 17205025 missense possibly damaging 0.71
R3963:Psg29 UTSW 7 17208585 missense probably benign 0.01
R4464:Psg29 UTSW 7 17210650 missense possibly damaging 0.61
R4740:Psg29 UTSW 7 17208533 missense probably benign 0.00
R4774:Psg29 UTSW 7 17210535 missense probably benign 0.23
R4902:Psg29 UTSW 7 17211912 makesense probably null
R4977:Psg29 UTSW 7 17208631 missense probably damaging 1.00
R5071:Psg29 UTSW 7 17211838 missense probably damaging 1.00
R5072:Psg29 UTSW 7 17211838 missense probably damaging 1.00
R5074:Psg29 UTSW 7 17211838 missense probably damaging 1.00
R5169:Psg29 UTSW 7 17211653 missense probably damaging 1.00
R5415:Psg29 UTSW 7 17211636 splice site probably null
R5729:Psg29 UTSW 7 17210534 missense probably damaging 0.98
R6023:Psg29 UTSW 7 17210512 missense possibly damaging 0.82
R6127:Psg29 UTSW 7 17211746 missense probably benign 0.00
R6900:Psg29 UTSW 7 17204932 nonsense probably null
R7142:Psg29 UTSW 7 17210621 missense probably damaging 1.00
R7297:Psg29 UTSW 7 17210691 nonsense probably null
R7448:Psg29 UTSW 7 17211723 missense possibly damaging 0.90
R7973:Psg29 UTSW 7 17210537 missense probably benign 0.03
R8027:Psg29 UTSW 7 17208640 missense possibly damaging 0.69
X0017:Psg29 UTSW 7 17210661 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TATGGTTCAAAGGGATGACCGTG -3'
(R):5'- AGTCTGAGCTATGGCCATTTG -3'

Sequencing Primer
(F):5'- GCACAGGCACCTTGAGATTG -3'
(R):5'- ACATGTTTGTCTGGCACTAAGTG -3'
Posted On2015-02-05