Incidental Mutation 'R3054:Cyp2a22'
ID265071
Institutional Source Beutler Lab
Gene Symbol Cyp2a22
Ensembl Gene ENSMUSG00000091867
Gene Namecytochrome P450, family 2, subfamily a, polypeptide 22
SynonymsEG233005
MMRRC Submission 040563-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R3054 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location26931631-26939384 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26938829 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 84 (D84G)
Ref Sequence ENSEMBL: ENSMUSP00000128030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170227]
Predicted Effect probably damaging
Transcript: ENSMUST00000170227
AA Change: D84G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128030
Gene: ENSMUSG00000091867
AA Change: D84G

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:p450 33 489 7.4e-148 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206957
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik A T 6: 52,179,128 probably benign Het
Aldh1l2 T C 10: 83,502,472 K528E probably benign Het
Als2 A G 1: 59,215,494 C235R probably damaging Het
Armc6 C A 8: 70,225,149 V177L probably benign Het
Asb7 A T 7: 66,679,211 V27D probably damaging Het
Bard1 A G 1: 71,088,231 V73A possibly damaging Het
Ccdc150 A G 1: 54,288,842 N361S possibly damaging Het
Cntn5 A G 9: 10,419,071 L7P probably benign Het
Cst3 A G 2: 148,872,031 S118P probably damaging Het
D330045A20Rik T A X: 139,511,557 V439E possibly damaging Het
Ddo A G 10: 40,631,742 N45S probably benign Het
Drd4 T C 7: 141,294,479 V319A probably damaging Het
Fat3 C T 9: 15,960,496 R3533H probably benign Het
Fras1 A T 5: 96,764,943 I3369F probably damaging Het
Gm5591 T C 7: 38,520,634 S272G probably benign Het
Gm8444 A T 15: 81,843,644 probably benign Het
Gm9776 A G 13: 94,358,650 probably benign Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Larp1b A T 3: 40,964,100 I59F probably benign Het
Ltn1 C T 16: 87,404,073 A1092T probably benign Het
Map1b A G 13: 99,432,742 V1157A unknown Het
Mboat1 A T 13: 30,195,741 M92L probably benign Het
Meis3 G T 7: 16,182,453 L284F probably damaging Het
Muc20 T C 16: 32,779,029 F3317L probably benign Het
Muc5b G T 7: 141,864,041 V3575F probably damaging Het
Polr1e C T 4: 45,018,724 T18I possibly damaging Het
Ppp4r1 G T 17: 65,836,079 A764S probably damaging Het
Psg29 A G 7: 17,208,802 T243A probably benign Het
Ptprn2 T C 12: 116,722,133 Y71H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sh3bp1 C T 15: 78,911,422 P584S probably benign Het
Slc4a4 T C 5: 89,225,948 V971A probably damaging Het
Stil T A 4: 115,004,966 H35Q probably damaging Het
Strn A T 17: 78,682,892 V65D probably damaging Het
Sumf1 T C 6: 108,153,204 N185D probably benign Het
Timm29 T C 9: 21,593,591 M185T probably damaging Het
Tjp3 T C 10: 81,280,507 K251R probably benign Het
Tubgcp6 A T 15: 89,122,603 M72K probably damaging Het
Utp14b T A 1: 78,664,725 D113E possibly damaging Het
Vps13b A G 15: 35,646,361 E1537G probably damaging Het
Zfr A G 15: 12,154,507 N592S probably damaging Het
Other mutations in Cyp2a22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Cyp2a22 APN 7 26937738 missense probably benign 0.09
IGL01111:Cyp2a22 APN 7 26936458 missense probably damaging 1.00
IGL01388:Cyp2a22 APN 7 26937792 missense probably benign 0.02
IGL01449:Cyp2a22 APN 7 26933553 missense probably benign 0.01
IGL01642:Cyp2a22 APN 7 26938759 missense possibly damaging 0.81
IGL02253:Cyp2a22 APN 7 26938237 splice site probably benign
IGL02327:Cyp2a22 APN 7 26934781 missense probably damaging 0.99
IGL02673:Cyp2a22 APN 7 26938100 missense probably benign 0.00
IGL02813:Cyp2a22 APN 7 26936434 missense probably benign 0.19
IGL02896:Cyp2a22 APN 7 26936461 missense probably damaging 0.98
IGL03193:Cyp2a22 APN 7 26936421 missense probably benign 0.00
IGL03350:Cyp2a22 APN 7 26934854 missense possibly damaging 0.88
R1648:Cyp2a22 UTSW 7 26932368 missense probably damaging 0.98
R1679:Cyp2a22 UTSW 7 26936311 nonsense probably null
R1733:Cyp2a22 UTSW 7 26934762 missense possibly damaging 0.78
R2001:Cyp2a22 UTSW 7 26934772 missense probably damaging 1.00
R2858:Cyp2a22 UTSW 7 26934262 missense probably damaging 0.99
R4528:Cyp2a22 UTSW 7 26934769 missense possibly damaging 0.95
R4623:Cyp2a22 UTSW 7 26933491 missense probably damaging 1.00
R4669:Cyp2a22 UTSW 7 26937855 missense possibly damaging 0.88
R4690:Cyp2a22 UTSW 7 26939209 nonsense probably null
R4840:Cyp2a22 UTSW 7 26932524 missense probably benign 0.13
R4915:Cyp2a22 UTSW 7 26937770 missense probably benign 0.33
R5071:Cyp2a22 UTSW 7 26932481 missense probably benign 0.01
R5072:Cyp2a22 UTSW 7 26932481 missense probably benign 0.01
R5074:Cyp2a22 UTSW 7 26932481 missense probably benign 0.01
R5147:Cyp2a22 UTSW 7 26936325 missense probably damaging 1.00
R5363:Cyp2a22 UTSW 7 26936433 missense probably damaging 0.99
R5705:Cyp2a22 UTSW 7 26939215 missense probably benign 0.05
R6014:Cyp2a22 UTSW 7 26939180 splice site probably null
R6042:Cyp2a22 UTSW 7 26934239 missense probably damaging 1.00
R6253:Cyp2a22 UTSW 7 26934232 missense probably benign 0.18
R6757:Cyp2a22 UTSW 7 26939204 missense probably benign 0.00
R6994:Cyp2a22 UTSW 7 26939181 critical splice donor site probably null
R7581:Cyp2a22 UTSW 7 26938148 missense possibly damaging 0.87
R8212:Cyp2a22 UTSW 7 26937780 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CCACACTGGAAAAGGCTTCTAAG -3'
(R):5'- ACTAGTGGGGTTTAGAAGGCTC -3'

Sequencing Primer
(F):5'- TTTAATCCCAGCACTCGGGAG -3'
(R):5'- CTCTGGAGCTATTTCAAGACTTTG -3'
Posted On2015-02-05