Incidental Mutation 'R3054:Timm29'
ID265081
Institutional Source Beutler Lab
Gene Symbol Timm29
Ensembl Gene ENSMUSG00000048429
Gene Nametranslocase of inner mitochondrial membrane 29
Synonyms1810026J23Rik
MMRRC Submission 040563-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.397) question?
Stock #R3054 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location21592722-21595970 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21593591 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 185 (M185T)
Ref Sequence ENSEMBL: ENSMUSP00000058283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034700] [ENSMUST00000034703] [ENSMUST00000062125] [ENSMUST00000078572] [ENSMUST00000115394] [ENSMUST00000115395] [ENSMUST00000130032] [ENSMUST00000180365] [ENSMUST00000213809]
Predicted Effect probably benign
Transcript: ENSMUST00000034700
SMART Domains Protein: ENSMUSP00000034700
Gene: ENSMUSG00000032182

DomainStartEndE-ValueType
Pfam:Yip1 84 272 1.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000034703
SMART Domains Protein: ENSMUSP00000034703
Gene: ENSMUSG00000032185

DomainStartEndE-ValueType
Pfam:CARM1 27 140 2.1e-71 PFAM
Pfam:PRMT5 144 447 2.3e-16 PFAM
Pfam:MTS 166 308 2.7e-10 PFAM
Pfam:Methyltransf_9 168 318 1.1e-9 PFAM
Pfam:PrmA 173 287 2.2e-12 PFAM
Pfam:Methyltransf_31 183 325 7.4e-11 PFAM
Pfam:Methyltransf_18 185 290 5.1e-12 PFAM
Pfam:Methyltransf_26 186 287 5.3e-10 PFAM
Pfam:Methyltransf_11 190 287 8.5e-7 PFAM
low complexity region 477 494 N/A INTRINSIC
low complexity region 562 576 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000062125
AA Change: M185T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058283
Gene: ENSMUSG00000048429
AA Change: M185T

DomainStartEndE-ValueType
Pfam:DUF2366 26 192 2.1e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078572
SMART Domains Protein: ENSMUSP00000077649
Gene: ENSMUSG00000032182

DomainStartEndE-ValueType
Pfam:Yip1 84 272 1.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115394
SMART Domains Protein: ENSMUSP00000111052
Gene: ENSMUSG00000032185

DomainStartEndE-ValueType
Pfam:CARM1 29 140 4.7e-63 PFAM
Pfam:PRMT5 145 447 4.1e-16 PFAM
Pfam:Methyltransf_9 168 318 1.4e-9 PFAM
Pfam:MTS 170 299 2.5e-9 PFAM
Pfam:PrmA 175 287 3.7e-12 PFAM
Pfam:Methyltransf_31 183 326 1.9e-10 PFAM
Pfam:Methyltransf_18 185 290 4e-9 PFAM
Pfam:Methyltransf_11 190 287 6.5e-7 PFAM
low complexity region 477 494 N/A INTRINSIC
low complexity region 606 619 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115395
SMART Domains Protein: ENSMUSP00000111053
Gene: ENSMUSG00000032185

DomainStartEndE-ValueType
Pfam:CARM1 27 140 2e-71 PFAM
Pfam:PRMT5 144 447 2.1e-16 PFAM
Pfam:MTS 166 308 2.6e-10 PFAM
Pfam:Methyltransf_9 168 318 1.1e-9 PFAM
Pfam:PrmA 172 287 2.1e-12 PFAM
Pfam:Methyltransf_31 183 326 6.9e-11 PFAM
Pfam:Methyltransf_18 185 290 4.8e-12 PFAM
Pfam:Methyltransf_26 186 287 5e-10 PFAM
Pfam:Methyltransf_11 190 287 8.1e-7 PFAM
low complexity region 477 494 N/A INTRINSIC
low complexity region 540 553 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130032
SMART Domains Protein: ENSMUSP00000117243
Gene: ENSMUSG00000032185

DomainStartEndE-ValueType
Pfam:CARM1 27 140 2.8e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154049
Predicted Effect probably benign
Transcript: ENSMUST00000180365
SMART Domains Protein: ENSMUSP00000136463
Gene: ENSMUSG00000032182

DomainStartEndE-ValueType
Pfam:Yip1 84 272 1.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213809
Predicted Effect probably benign
Transcript: ENSMUST00000216160
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik A T 6: 52,179,128 probably benign Het
Aldh1l2 T C 10: 83,502,472 K528E probably benign Het
Als2 A G 1: 59,215,494 C235R probably damaging Het
Armc6 C A 8: 70,225,149 V177L probably benign Het
Asb7 A T 7: 66,679,211 V27D probably damaging Het
Bard1 A G 1: 71,088,231 V73A possibly damaging Het
Ccdc150 A G 1: 54,288,842 N361S possibly damaging Het
Cntn5 A G 9: 10,419,071 L7P probably benign Het
Cst3 A G 2: 148,872,031 S118P probably damaging Het
Cyp2a22 T C 7: 26,938,829 D84G probably damaging Het
D330045A20Rik T A X: 139,511,557 V439E possibly damaging Het
Ddo A G 10: 40,631,742 N45S probably benign Het
Drd4 T C 7: 141,294,479 V319A probably damaging Het
Fat3 C T 9: 15,960,496 R3533H probably benign Het
Fras1 A T 5: 96,764,943 I3369F probably damaging Het
Gm5591 T C 7: 38,520,634 S272G probably benign Het
Gm8444 A T 15: 81,843,644 probably benign Het
Gm9776 A G 13: 94,358,650 probably benign Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Larp1b A T 3: 40,964,100 I59F probably benign Het
Ltn1 C T 16: 87,404,073 A1092T probably benign Het
Map1b A G 13: 99,432,742 V1157A unknown Het
Mboat1 A T 13: 30,195,741 M92L probably benign Het
Meis3 G T 7: 16,182,453 L284F probably damaging Het
Muc20 T C 16: 32,779,029 F3317L probably benign Het
Muc5b G T 7: 141,864,041 V3575F probably damaging Het
Polr1e C T 4: 45,018,724 T18I possibly damaging Het
Ppp4r1 G T 17: 65,836,079 A764S probably damaging Het
Psg29 A G 7: 17,208,802 T243A probably benign Het
Ptprn2 T C 12: 116,722,133 Y71H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sh3bp1 C T 15: 78,911,422 P584S probably benign Het
Slc4a4 T C 5: 89,225,948 V971A probably damaging Het
Stil T A 4: 115,004,966 H35Q probably damaging Het
Strn A T 17: 78,682,892 V65D probably damaging Het
Sumf1 T C 6: 108,153,204 N185D probably benign Het
Tjp3 T C 10: 81,280,507 K251R probably benign Het
Tubgcp6 A T 15: 89,122,603 M72K probably damaging Het
Utp14b T A 1: 78,664,725 D113E possibly damaging Het
Vps13b A G 15: 35,646,361 E1537G probably damaging Het
Zfr A G 15: 12,154,507 N592S probably damaging Het
Other mutations in Timm29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01734:Timm29 APN 9 21593735 missense probably damaging 0.97
R0063:Timm29 UTSW 9 21593008 missense probably benign 0.22
R0295:Timm29 UTSW 9 21593076 splice site probably null
R3056:Timm29 UTSW 9 21593591 missense probably damaging 1.00
R4429:Timm29 UTSW 9 21593479 missense probably damaging 0.99
R5853:Timm29 UTSW 9 21593453 missense probably damaging 0.99
R7168:Timm29 UTSW 9 21593453 missense probably damaging 0.99
R8329:Timm29 UTSW 9 21593705 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACGTGAACCTGGGCTTTTG -3'
(R):5'- ATCGGACTGAACCAGTGAATCAG -3'

Sequencing Primer
(F):5'- GCTCGCTGGTTTACGAAGC -3'
(R):5'- TGAACCAGTGAATCAGCCTCG -3'
Posted On2015-02-05