Incidental Mutation 'R3054:Ptprn2'
ID265086
Institutional Source Beutler Lab
Gene Symbol Ptprn2
Ensembl Gene ENSMUSG00000056553
Gene Nameprotein tyrosine phosphatase, receptor type, N polypeptide 2
Synonymsphogrin, 4930425H11Rik, IA-2 beta, PTP-NP, IA-2beta
MMRRC Submission 040563-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock #R3054 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location116485720-117276849 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116722133 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 71 (Y71H)
Ref Sequence ENSEMBL: ENSMUSP00000139978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070733] [ENSMUST00000190247]
Predicted Effect probably damaging
Transcript: ENSMUST00000070733
AA Change: Y71H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064046
Gene: ENSMUSG00000056553
AA Change: Y71H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 495 583 1.5e-35 PFAM
low complexity region 687 707 N/A INTRINSIC
PTPc 730 993 4.42e-119 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185505
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189009
Predicted Effect probably damaging
Transcript: ENSMUST00000190247
AA Change: Y71H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139978
Gene: ENSMUSG00000056553
AA Change: Y71H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 494 584 2.5e-43 PFAM
transmembrane domain 602 624 N/A INTRINSIC
low complexity region 687 707 N/A INTRINSIC
PTPc 730 932 8.81e-64 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191106
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to receptor-like protein tyrosine phosphatases. However, tyrosine phosphatase activity has not been experimentally validated for this protein. Studies of the rat ortholog suggest that the encoded protein may instead function as a phosphatidylinositol phosphatase with the ability to dephosphorylate phosphatidylinositol 3-phosphate and phosphatidylinositol 4,5-diphosphate, and this function may be involved in the regulation of insulin secretion. This protein has been identified as an autoantigen in insulin-dependent diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous null mice display impaired glucose tolerance but normal fasting and non-fasting blood glucose and insulin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik A T 6: 52,179,128 probably benign Het
Aldh1l2 T C 10: 83,502,472 K528E probably benign Het
Als2 A G 1: 59,215,494 C235R probably damaging Het
Armc6 C A 8: 70,225,149 V177L probably benign Het
Asb7 A T 7: 66,679,211 V27D probably damaging Het
Bard1 A G 1: 71,088,231 V73A possibly damaging Het
Ccdc150 A G 1: 54,288,842 N361S possibly damaging Het
Cntn5 A G 9: 10,419,071 L7P probably benign Het
Cst3 A G 2: 148,872,031 S118P probably damaging Het
Cyp2a22 T C 7: 26,938,829 D84G probably damaging Het
D330045A20Rik T A X: 139,511,557 V439E possibly damaging Het
Ddo A G 10: 40,631,742 N45S probably benign Het
Drd4 T C 7: 141,294,479 V319A probably damaging Het
Fat3 C T 9: 15,960,496 R3533H probably benign Het
Fras1 A T 5: 96,764,943 I3369F probably damaging Het
Gm5591 T C 7: 38,520,634 S272G probably benign Het
Gm8444 A T 15: 81,843,644 probably benign Het
Gm9776 A G 13: 94,358,650 probably benign Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Larp1b A T 3: 40,964,100 I59F probably benign Het
Ltn1 C T 16: 87,404,073 A1092T probably benign Het
Map1b A G 13: 99,432,742 V1157A unknown Het
Mboat1 A T 13: 30,195,741 M92L probably benign Het
Meis3 G T 7: 16,182,453 L284F probably damaging Het
Muc20 T C 16: 32,779,029 F3317L probably benign Het
Muc5b G T 7: 141,864,041 V3575F probably damaging Het
Polr1e C T 4: 45,018,724 T18I possibly damaging Het
Ppp4r1 G T 17: 65,836,079 A764S probably damaging Het
Psg29 A G 7: 17,208,802 T243A probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sh3bp1 C T 15: 78,911,422 P584S probably benign Het
Slc4a4 T C 5: 89,225,948 V971A probably damaging Het
Stil T A 4: 115,004,966 H35Q probably damaging Het
Strn A T 17: 78,682,892 V65D probably damaging Het
Sumf1 T C 6: 108,153,204 N185D probably benign Het
Timm29 T C 9: 21,593,591 M185T probably damaging Het
Tjp3 T C 10: 81,280,507 K251R probably benign Het
Tubgcp6 A T 15: 89,122,603 M72K probably damaging Het
Utp14b T A 1: 78,664,725 D113E possibly damaging Het
Vps13b A G 15: 35,646,361 E1537G probably damaging Het
Zfr A G 15: 12,154,507 N592S probably damaging Het
Other mutations in Ptprn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01695:Ptprn2 APN 12 116841388 missense probably benign 0.02
IGL01788:Ptprn2 APN 12 116900987 missense probably damaging 0.98
IGL02172:Ptprn2 APN 12 116873697 splice site probably benign
IGL02339:Ptprn2 APN 12 116722104 missense probably damaging 1.00
IGL02706:Ptprn2 APN 12 116888898 missense probably damaging 0.96
IGL03018:Ptprn2 APN 12 117211943 missense probably damaging 1.00
IGL03267:Ptprn2 APN 12 116876344 nonsense probably null
BB001:Ptprn2 UTSW 12 116841264 missense probably benign 0.00
BB011:Ptprn2 UTSW 12 116841264 missense probably benign 0.00
IGL03014:Ptprn2 UTSW 12 117248688 missense probably damaging 1.00
R0066:Ptprn2 UTSW 12 117276602 missense probably benign 0.07
R0066:Ptprn2 UTSW 12 117276602 missense probably benign 0.07
R0115:Ptprn2 UTSW 12 117211846 splice site probably benign
R0131:Ptprn2 UTSW 12 116722091 missense probably damaging 1.00
R0131:Ptprn2 UTSW 12 116722091 missense probably damaging 1.00
R0132:Ptprn2 UTSW 12 116722091 missense probably damaging 1.00
R0481:Ptprn2 UTSW 12 117211846 splice site probably benign
R0694:Ptprn2 UTSW 12 116824355 missense possibly damaging 0.69
R0698:Ptprn2 UTSW 12 116722130 nonsense probably null
R0746:Ptprn2 UTSW 12 116901017 missense probably benign 0.00
R1127:Ptprn2 UTSW 12 117212008 splice site probably null
R1443:Ptprn2 UTSW 12 117253615 missense probably damaging 1.00
R1508:Ptprn2 UTSW 12 117184722 missense probably damaging 1.00
R1664:Ptprn2 UTSW 12 117161709 missense probably damaging 0.99
R1670:Ptprn2 UTSW 12 116722172 missense possibly damaging 0.64
R1749:Ptprn2 UTSW 12 116580428 missense probably benign 0.00
R2075:Ptprn2 UTSW 12 117247717 missense probably benign 0.01
R3107:Ptprn2 UTSW 12 116876180 missense probably benign 0.04
R3109:Ptprn2 UTSW 12 116876180 missense probably benign 0.04
R3552:Ptprn2 UTSW 12 116888877 missense probably benign 0.00
R4193:Ptprn2 UTSW 12 116901008 missense probably benign 0.01
R4523:Ptprn2 UTSW 12 116876000 missense probably damaging 1.00
R4706:Ptprn2 UTSW 12 116872094 missense probably benign 0.02
R4719:Ptprn2 UTSW 12 116824396 missense possibly damaging 0.95
R4726:Ptprn2 UTSW 12 117247773 nonsense probably null
R4872:Ptprn2 UTSW 12 117161694 missense probably damaging 1.00
R4891:Ptprn2 UTSW 12 117233365 splice site probably null
R4970:Ptprn2 UTSW 12 117276595 missense probably damaging 1.00
R5208:Ptprn2 UTSW 12 116858928 missense probably damaging 1.00
R5287:Ptprn2 UTSW 12 117211862 missense probably damaging 1.00
R5419:Ptprn2 UTSW 12 117184647 missense probably damaging 0.99
R6035:Ptprn2 UTSW 12 117255595 missense probably damaging 1.00
R6035:Ptprn2 UTSW 12 117255595 missense probably damaging 1.00
R6180:Ptprn2 UTSW 12 116859119 missense probably benign 0.05
R6277:Ptprn2 UTSW 12 116876180 missense probably benign 0.04
R6465:Ptprn2 UTSW 12 117269589 missense probably damaging 0.96
R6488:Ptprn2 UTSW 12 116872038 missense probably benign 0.13
R6555:Ptprn2 UTSW 12 117227200 missense probably damaging 1.00
R6908:Ptprn2 UTSW 12 116888888 missense probably benign 0.06
R7120:Ptprn2 UTSW 12 116872056 missense probably benign 0.01
R7229:Ptprn2 UTSW 12 117227225 splice site probably null
R7237:Ptprn2 UTSW 12 117161727 missense probably benign 0.03
R7304:Ptprn2 UTSW 12 117248544 missense probably damaging 1.00
R7355:Ptprn2 UTSW 12 116858951 missense probably benign
R7460:Ptprn2 UTSW 12 117248681 missense probably benign 0.05
R7577:Ptprn2 UTSW 12 116485866 start codon destroyed probably null
R7658:Ptprn2 UTSW 12 116722119 missense probably benign 0.01
R7666:Ptprn2 UTSW 12 116841320 missense probably benign 0.10
R7924:Ptprn2 UTSW 12 116841264 missense probably benign 0.00
R8219:Ptprn2 UTSW 12 117184737 missense probably benign 0.30
R8716:Ptprn2 UTSW 12 117255548 missense possibly damaging 0.73
X0066:Ptprn2 UTSW 12 117161760 missense probably damaging 1.00
X0066:Ptprn2 UTSW 12 117184740 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- ACAGTGCACATTTCTGGGTG -3'
(R):5'- TCCTGAGTCCACACATCTAATG -3'

Sequencing Primer
(F):5'- GAGTTACAGTGCTCTCTGCTGC -3'
(R):5'- GCAAAGCCTTTCTTACTACAGG -3'
Posted On2015-02-05