Incidental Mutation 'R3054:Mboat1'
ID265087
Institutional Source Beutler Lab
Gene Symbol Mboat1
Ensembl Gene ENSMUSG00000038732
Gene Namemembrane bound O-acyltransferase domain containing 1
Synonyms9130215M02Rik, Oact1
MMRRC Submission 040563-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3054 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location30136489-30246717 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30195741 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 92 (M92L)
Ref Sequence ENSEMBL: ENSMUSP00000045441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047311]
Predicted Effect probably benign
Transcript: ENSMUST00000047311
AA Change: M92L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045441
Gene: ENSMUSG00000038732
AA Change: M92L

DomainStartEndE-ValueType
Pfam:MBOAT 36 438 4.8e-29 PFAM
transmembrane domain 455 472 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152798
SMART Domains Protein: ENSMUSP00000121195
Gene: ENSMUSG00000038732

DomainStartEndE-ValueType
Pfam:MBOAT 9 209 1.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220870
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the membrane-bound O-acetyltransferase superfamily. The encoded transmembrane protein is an enzyme that transfers organic compounds, preferably from oleoyl-CoA, to hydroxyl groups of protein targets in membranes. A translocation disrupting this gene may be associated with brachydactyly syndactyly syndrome. Alternately spliced transcript variants have been described for this gene. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik A T 6: 52,179,128 probably benign Het
Aldh1l2 T C 10: 83,502,472 K528E probably benign Het
Als2 A G 1: 59,215,494 C235R probably damaging Het
Armc6 C A 8: 70,225,149 V177L probably benign Het
Asb7 A T 7: 66,679,211 V27D probably damaging Het
Bard1 A G 1: 71,088,231 V73A possibly damaging Het
Ccdc150 A G 1: 54,288,842 N361S possibly damaging Het
Cntn5 A G 9: 10,419,071 L7P probably benign Het
Cst3 A G 2: 148,872,031 S118P probably damaging Het
Cyp2a22 T C 7: 26,938,829 D84G probably damaging Het
D330045A20Rik T A X: 139,511,557 V439E possibly damaging Het
Ddo A G 10: 40,631,742 N45S probably benign Het
Drd4 T C 7: 141,294,479 V319A probably damaging Het
Fat3 C T 9: 15,960,496 R3533H probably benign Het
Fras1 A T 5: 96,764,943 I3369F probably damaging Het
Gm5591 T C 7: 38,520,634 S272G probably benign Het
Gm8444 A T 15: 81,843,644 probably benign Het
Gm9776 A G 13: 94,358,650 probably benign Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Larp1b A T 3: 40,964,100 I59F probably benign Het
Ltn1 C T 16: 87,404,073 A1092T probably benign Het
Map1b A G 13: 99,432,742 V1157A unknown Het
Meis3 G T 7: 16,182,453 L284F probably damaging Het
Muc20 T C 16: 32,779,029 F3317L probably benign Het
Muc5b G T 7: 141,864,041 V3575F probably damaging Het
Polr1e C T 4: 45,018,724 T18I possibly damaging Het
Ppp4r1 G T 17: 65,836,079 A764S probably damaging Het
Psg29 A G 7: 17,208,802 T243A probably benign Het
Ptprn2 T C 12: 116,722,133 Y71H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sh3bp1 C T 15: 78,911,422 P584S probably benign Het
Slc4a4 T C 5: 89,225,948 V971A probably damaging Het
Stil T A 4: 115,004,966 H35Q probably damaging Het
Strn A T 17: 78,682,892 V65D probably damaging Het
Sumf1 T C 6: 108,153,204 N185D probably benign Het
Timm29 T C 9: 21,593,591 M185T probably damaging Het
Tjp3 T C 10: 81,280,507 K251R probably benign Het
Tubgcp6 A T 15: 89,122,603 M72K probably damaging Het
Utp14b T A 1: 78,664,725 D113E possibly damaging Het
Vps13b A G 15: 35,646,361 E1537G probably damaging Het
Zfr A G 15: 12,154,507 N592S probably damaging Het
Other mutations in Mboat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Mboat1 APN 13 30195793 splice site probably benign
IGL01331:Mboat1 APN 13 30219701 splice site probably benign
IGL01837:Mboat1 APN 13 30241183 missense possibly damaging 0.72
IGL02070:Mboat1 APN 13 30224397 missense probably benign 0.02
IGL03338:Mboat1 APN 13 30136759 missense probably benign 0.01
langsat UTSW 13 30202375 missense probably benign 0.37
R0201:Mboat1 UTSW 13 30202375 missense probably benign 0.37
R0322:Mboat1 UTSW 13 30232080 splice site probably benign
R0448:Mboat1 UTSW 13 30202410 missense probably damaging 1.00
R1793:Mboat1 UTSW 13 30219650 missense probably damaging 0.99
R2040:Mboat1 UTSW 13 30241317 critical splice donor site probably null
R3122:Mboat1 UTSW 13 30238048 missense probably damaging 1.00
R4948:Mboat1 UTSW 13 30241230 missense probably damaging 1.00
R4958:Mboat1 UTSW 13 30224393 missense probably damaging 1.00
R4992:Mboat1 UTSW 13 30202360 missense possibly damaging 0.80
R5429:Mboat1 UTSW 13 30219667 missense probably benign 0.02
R5862:Mboat1 UTSW 13 30235697 missense probably damaging 1.00
R6025:Mboat1 UTSW 13 30224526 missense probably benign
R6352:Mboat1 UTSW 13 30202420 missense possibly damaging 0.59
R6956:Mboat1 UTSW 13 30238076 missense possibly damaging 0.89
R7088:Mboat1 UTSW 13 30195789 critical splice donor site probably null
R7165:Mboat1 UTSW 13 30224415 missense probably damaging 1.00
R7366:Mboat1 UTSW 13 30202362 missense possibly damaging 0.94
R7727:Mboat1 UTSW 13 30226306 missense probably benign 0.00
Z1177:Mboat1 UTSW 13 30226378 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGCAACTGTAAACTGTGTCCAG -3'
(R):5'- TGAAGATTCCTATCCTCCCGG -3'

Sequencing Primer
(F):5'- GCAACTGTAAACTGTGTCCAGGTTTC -3'
(R):5'- GGTTCTCTTCTATCCTGGAGAC -3'
Posted On2015-02-05