Incidental Mutation 'I1329:Scin'
ID26509
Institutional Source Beutler Lab
Gene Symbol Scin
Ensembl Gene ENSMUSG00000002565
Gene Namescinderin
Synonymsadseverin
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #I1329 (G1) of strain toku
Quality Score225
Status Validated (trace)
Chromosome12
Chromosomal Location40059769-40134228 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40073330 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 518 (N518I)
Ref Sequence ENSEMBL: ENSMUSP00000077573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002640] [ENSMUST00000078481]
Predicted Effect probably damaging
Transcript: ENSMUST00000002640
AA Change: N518I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000002640
Gene: ENSMUSG00000002565
AA Change: N518I

DomainStartEndE-ValueType
GEL 17 114 3.44e-26 SMART
GEL 135 227 3.92e-30 SMART
low complexity region 232 242 N/A INTRINSIC
GEL 252 347 6.56e-32 SMART
GEL 396 489 7.72e-29 SMART
GEL 510 596 2.33e-23 SMART
GEL 615 710 2.07e-29 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000078481
AA Change: N518I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000077573
Gene: ENSMUSG00000002565
AA Change: N518I

DomainStartEndE-ValueType
GEL 17 114 3.44e-26 SMART
GEL 135 227 3.92e-30 SMART
low complexity region 232 242 N/A INTRINSIC
GEL 252 347 6.56e-32 SMART
GEL 396 489 7.72e-29 SMART
GEL 510 610 1.09e-28 SMART
Meta Mutation Damage Score 0.2507 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 95.2%
Validation Efficiency 89% (42/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SCIN is a Ca(2+)-dependent actin-severing and -capping protein (Zunino et al., 2001 [PubMed 11568009]).[supplied by OMIM, May 2010]
PHENOTYPE: Mice homozygous for a conditional allele knocked-out in osteoclasts exhibit impaired osteoclast differentiation and reduced peridontal disease-mediated bone loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,245,194 S542P probably benign Het
Adamts13 T C 2: 26,973,619 I28T possibly damaging Het
Agbl4 T A 4: 110,478,455 probably benign Het
Aspscr1 G C 11: 120,701,240 V268L probably damaging Het
Btbd10 A G 7: 113,332,875 S115P probably benign Het
Cercam T A 2: 29,871,085 V132E probably damaging Het
Decr1 G A 4: 15,930,976 R119* probably null Het
Dlst T C 12: 85,123,841 M248T probably damaging Het
Erbb3 T C 10: 128,583,454 N215S possibly damaging Het
Flnc G A 6: 29,451,415 V1543M probably damaging Het
Gk5 GCC GC 9: 96,140,629 probably null Het
Glrb T A 3: 80,862,074 R115S probably damaging Het
Gm5592 T A 7: 41,286,354 Y93* probably null Het
Gpr20 C T 15: 73,695,763 R259H probably damaging Het
Il1rap A G 16: 26,692,850 T215A probably benign Het
Ipmk T C 10: 71,381,447 C275R possibly damaging Het
Lats1 A G 10: 7,712,802 N1061S probably benign Het
Nkain3 A G 4: 20,158,329 probably benign Het
Nr1h4 A G 10: 89,483,362 probably benign Het
Nr4a3 A G 4: 48,051,585 Q142R probably benign Het
Otog G A 7: 46,246,503 V131I probably benign Het
Parp12 A T 6: 39,087,571 M627K probably damaging Het
Pcdh9 A G 14: 93,886,209 S842P probably benign Het
Phc2 G C 4: 128,711,113 G214A probably damaging Het
Prpf40a C A 2: 53,176,395 V92L probably benign Het
Qser1 A T 2: 104,786,977 Y1163* probably null Het
Rpe65 A G 3: 159,624,723 D509G probably benign Het
Sfswap G T 5: 129,507,137 probably benign Het
Tfpi A T 2: 84,444,116 N182K possibly damaging Het
Tph1 A G 7: 46,650,013 L368P probably damaging Het
Ttn T C 2: 76,741,572 T26326A possibly damaging Het
Ubr1 G A 2: 120,934,294 probably benign Het
Usf3 G T 16: 44,220,530 C1791F probably damaging Het
Vmn1r16 T G 6: 57,323,534 R34S probably damaging Het
Ylpm1 C A 12: 85,040,880 P1604Q probably damaging Het
Zc3h12a A G 4: 125,119,364 V569A possibly damaging Het
Zmynd8 A G 2: 165,828,225 F488S probably damaging Het
Other mutations in Scin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Scin APN 12 40076972 missense probably benign 0.03
IGL01414:Scin APN 12 40124699 missense probably damaging 1.00
IGL01790:Scin APN 12 40063257 missense probably benign 0.02
IGL01807:Scin APN 12 40084289 missense probably damaging 1.00
IGL01946:Scin APN 12 40060491 utr 3 prime probably benign
IGL02040:Scin APN 12 40069453 intron probably benign
IGL02391:Scin APN 12 40077531 missense probably benign 0.05
IGL03221:Scin APN 12 40076974 missense probably benign 0.01
PIT4498001:Scin UTSW 12 40069447 critical splice acceptor site probably null
R0108:Scin UTSW 12 40127987 missense possibly damaging 0.68
R0470:Scin UTSW 12 40073292 splice site probably benign
R0477:Scin UTSW 12 40060516 missense probably damaging 1.00
R0538:Scin UTSW 12 40081771 missense probably damaging 0.98
R0539:Scin UTSW 12 40081766 missense possibly damaging 0.65
R0591:Scin UTSW 12 40080930 critical splice donor site probably null
R0668:Scin UTSW 12 40080949 missense probably damaging 1.00
R0718:Scin UTSW 12 40079607 missense probably damaging 1.00
R1473:Scin UTSW 12 40077502 missense probably benign
R1566:Scin UTSW 12 40081674 missense probably benign 0.17
R1570:Scin UTSW 12 40084381 splice site probably benign
R1624:Scin UTSW 12 40127930 missense probably benign
R1827:Scin UTSW 12 40068923 missense possibly damaging 0.88
R1836:Scin UTSW 12 40124698 missense probably damaging 1.00
R1985:Scin UTSW 12 40133908 critical splice donor site probably null
R2042:Scin UTSW 12 40077510 missense possibly damaging 0.96
R2061:Scin UTSW 12 40080948 missense probably damaging 1.00
R2147:Scin UTSW 12 40080985 missense probably benign 0.00
R2232:Scin UTSW 12 40068931 missense probably damaging 1.00
R2504:Scin UTSW 12 40081706 missense probably benign 0.02
R4781:Scin UTSW 12 40081764 missense possibly damaging 0.59
R4898:Scin UTSW 12 40104932 missense probably benign
R4914:Scin UTSW 12 40069374 missense possibly damaging 0.79
R4915:Scin UTSW 12 40069374 missense possibly damaging 0.79
R4916:Scin UTSW 12 40069374 missense possibly damaging 0.79
R4917:Scin UTSW 12 40069374 missense possibly damaging 0.79
R4918:Scin UTSW 12 40069374 missense possibly damaging 0.79
R5068:Scin UTSW 12 40124700 missense probably damaging 1.00
R5098:Scin UTSW 12 40077542 nonsense probably null
R5233:Scin UTSW 12 40077559 missense probably benign
R5564:Scin UTSW 12 40124569 missense probably benign
R5677:Scin UTSW 12 40063259 missense probably damaging 1.00
R5967:Scin UTSW 12 40077538 missense probably benign 0.35
R6027:Scin UTSW 12 40077516 missense probably damaging 1.00
R6130:Scin UTSW 12 40069436 missense probably benign 0.01
R6134:Scin UTSW 12 40060579 missense probably damaging 1.00
R6135:Scin UTSW 12 40079808 missense possibly damaging 0.80
R6439:Scin UTSW 12 40068946 missense probably damaging 0.99
R6613:Scin UTSW 12 40079715 missense probably benign 0.04
R7127:Scin UTSW 12 40105072 missense possibly damaging 0.69
R7234:Scin UTSW 12 40080958 nonsense probably null
R7431:Scin UTSW 12 40133922 missense probably damaging 1.00
R7609:Scin UTSW 12 40124589 missense probably damaging 1.00
R7665:Scin UTSW 12 40069415 missense probably damaging 1.00
R7704:Scin UTSW 12 40124688 missense possibly damaging 0.93
R7904:Scin UTSW 12 40077000 missense probably damaging 1.00
R7987:Scin UTSW 12 40077000 missense probably damaging 1.00
R7995:Scin UTSW 12 40079805 missense probably benign 0.00
X0018:Scin UTSW 12 40069433 missense probably damaging 1.00
Z1176:Scin UTSW 12 40079604 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- AAAACCTGAGCTGCCCTCTCATTC -3'
(R):5'- TCCCAAACTGTGCTACCATGCC -3'

Sequencing Primer
(F):5'- TCATTCAATGTTTCCTCTTCTAGTG -3'
(R):5'- GAAGATACTTCTCAGGTAGCCGC -3'
Posted On2013-04-16