Incidental Mutation 'R3054:Sh3bp1'
ID265094
Institutional Source Beutler Lab
Gene Symbol Sh3bp1
Ensembl Gene ENSMUSG00000022436
Gene NameSH3-domain binding protein 1
Synonyms3BP-1
MMRRC Submission 040563-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R3054 (G1)
Quality Score155
Status Not validated
Chromosome15
Chromosomal Location78899768-78912051 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 78911422 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 584 (P584S)
Ref Sequence ENSEMBL: ENSMUSP00000001226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001226] [ENSMUST00000061239] [ENSMUST00000089378] [ENSMUST00000109698] [ENSMUST00000132047] [ENSMUST00000134703] [ENSMUST00000151146]
Predicted Effect probably benign
Transcript: ENSMUST00000001226
AA Change: P584S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000001226
Gene: ENSMUSG00000022436
AA Change: P584S

DomainStartEndE-ValueType
Pfam:BAR 2 254 7e-37 PFAM
RhoGAP 287 466 2.04e-63 SMART
low complexity region 500 518 N/A INTRINSIC
low complexity region 558 593 N/A INTRINSIC
low complexity region 604 633 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000061239
SMART Domains Protein: ENSMUSP00000052181
Gene: ENSMUSG00000022436

DomainStartEndE-ValueType
Pfam:BAR 2 254 2.2e-36 PFAM
RhoGAP 287 466 2.04e-63 SMART
low complexity region 500 518 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089378
SMART Domains Protein: ENSMUSP00000086796
Gene: ENSMUSG00000116165

DomainStartEndE-ValueType
Pfam:Hydrolase 19 247 3.6e-13 PFAM
Pfam:Hydrolase_6 22 128 3.2e-29 PFAM
Pfam:Hydrolase_like 206 286 2.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109698
SMART Domains Protein: ENSMUSP00000105320
Gene: ENSMUSG00000022436

DomainStartEndE-ValueType
Pfam:BAR 2 254 2.2e-36 PFAM
RhoGAP 287 466 2.04e-63 SMART
low complexity region 500 518 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132047
SMART Domains Protein: ENSMUSP00000138598
Gene: ENSMUSG00000022436

DomainStartEndE-ValueType
Pfam:BAR 2 254 5.4e-36 PFAM
RhoGAP 287 466 2.04e-63 SMART
low complexity region 500 518 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150472
Predicted Effect probably benign
Transcript: ENSMUST00000151146
SMART Domains Protein: ENSMUSP00000138780
Gene: ENSMUSG00000022436

DomainStartEndE-ValueType
Pfam:BAR 2 143 9e-22 PFAM
low complexity region 160 177 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231057
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik A T 6: 52,179,128 probably benign Het
Aldh1l2 T C 10: 83,502,472 K528E probably benign Het
Als2 A G 1: 59,215,494 C235R probably damaging Het
Armc6 C A 8: 70,225,149 V177L probably benign Het
Asb7 A T 7: 66,679,211 V27D probably damaging Het
Bard1 A G 1: 71,088,231 V73A possibly damaging Het
Ccdc150 A G 1: 54,288,842 N361S possibly damaging Het
Cntn5 A G 9: 10,419,071 L7P probably benign Het
Cst3 A G 2: 148,872,031 S118P probably damaging Het
Cyp2a22 T C 7: 26,938,829 D84G probably damaging Het
D330045A20Rik T A X: 139,511,557 V439E possibly damaging Het
Ddo A G 10: 40,631,742 N45S probably benign Het
Drd4 T C 7: 141,294,479 V319A probably damaging Het
Fat3 C T 9: 15,960,496 R3533H probably benign Het
Fras1 A T 5: 96,764,943 I3369F probably damaging Het
Gm5591 T C 7: 38,520,634 S272G probably benign Het
Gm8444 A T 15: 81,843,644 probably benign Het
Gm9776 A G 13: 94,358,650 probably benign Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Larp1b A T 3: 40,964,100 I59F probably benign Het
Ltn1 C T 16: 87,404,073 A1092T probably benign Het
Map1b A G 13: 99,432,742 V1157A unknown Het
Mboat1 A T 13: 30,195,741 M92L probably benign Het
Meis3 G T 7: 16,182,453 L284F probably damaging Het
Muc20 T C 16: 32,779,029 F3317L probably benign Het
Muc5b G T 7: 141,864,041 V3575F probably damaging Het
Polr1e C T 4: 45,018,724 T18I possibly damaging Het
Ppp4r1 G T 17: 65,836,079 A764S probably damaging Het
Psg29 A G 7: 17,208,802 T243A probably benign Het
Ptprn2 T C 12: 116,722,133 Y71H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc4a4 T C 5: 89,225,948 V971A probably damaging Het
Stil T A 4: 115,004,966 H35Q probably damaging Het
Strn A T 17: 78,682,892 V65D probably damaging Het
Sumf1 T C 6: 108,153,204 N185D probably benign Het
Timm29 T C 9: 21,593,591 M185T probably damaging Het
Tjp3 T C 10: 81,280,507 K251R probably benign Het
Tubgcp6 A T 15: 89,122,603 M72K probably damaging Het
Utp14b T A 1: 78,664,725 D113E possibly damaging Het
Vps13b A G 15: 35,646,361 E1537G probably damaging Het
Zfr A G 15: 12,154,507 N592S probably damaging Het
Other mutations in Sh3bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Sh3bp1 APN 15 78905114 missense possibly damaging 0.58
IGL01879:Sh3bp1 APN 15 78907992 missense probably damaging 1.00
IGL02112:Sh3bp1 APN 15 78905884 critical splice donor site probably null
IGL02216:Sh3bp1 APN 15 78905164 missense probably benign 0.07
IGL02385:Sh3bp1 APN 15 78905888 splice site probably benign
IGL02417:Sh3bp1 APN 15 78901499 missense probably damaging 1.00
IGL02551:Sh3bp1 APN 15 78904338 missense probably benign 0.01
PIT1430001:Sh3bp1 UTSW 15 78914024 missense probably benign
PIT4585001:Sh3bp1 UTSW 15 78910076 missense possibly damaging 0.49
R0255:Sh3bp1 UTSW 15 78904334 nonsense probably null
R0318:Sh3bp1 UTSW 15 78911707 missense probably damaging 0.97
R0544:Sh3bp1 UTSW 15 78905775 missense probably damaging 1.00
R0554:Sh3bp1 UTSW 15 78907267 missense probably damaging 1.00
R1424:Sh3bp1 UTSW 15 78903699 critical splice donor site probably null
R1465:Sh3bp1 UTSW 15 78907345 splice site probably benign
R1813:Sh3bp1 UTSW 15 78903680 missense probably damaging 0.96
R1835:Sh3bp1 UTSW 15 78905150 missense probably damaging 1.00
R2291:Sh3bp1 UTSW 15 78918319 missense possibly damaging 0.93
R2415:Sh3bp1 UTSW 15 78901161 start gained probably benign
R2509:Sh3bp1 UTSW 15 78911506 missense probably damaging 1.00
R2511:Sh3bp1 UTSW 15 78911506 missense probably damaging 1.00
R3827:Sh3bp1 UTSW 15 78904497 missense possibly damaging 0.67
R3855:Sh3bp1 UTSW 15 78901161 start gained probably benign
R4767:Sh3bp1 UTSW 15 78904497 missense possibly damaging 0.67
R4787:Sh3bp1 UTSW 15 78907995 missense possibly damaging 0.80
R4852:Sh3bp1 UTSW 15 78904338 missense probably benign 0.01
R4872:Sh3bp1 UTSW 15 78908037 missense probably benign 0.31
R5194:Sh3bp1 UTSW 15 78903101 missense probably damaging 1.00
R6320:Sh3bp1 UTSW 15 78911515 missense probably damaging 1.00
R6322:Sh3bp1 UTSW 15 78911515 missense probably damaging 1.00
R6569:Sh3bp1 UTSW 15 78911696 missense probably damaging 1.00
R6678:Sh3bp1 UTSW 15 78908514 critical splice donor site probably null
R6905:Sh3bp1 UTSW 15 78905030 missense probably benign 0.00
R7564:Sh3bp1 UTSW 15 78911560 missense probably damaging 1.00
R7744:Sh3bp1 UTSW 15 78910009 missense possibly damaging 0.61
R7916:Sh3bp1 UTSW 15 78907221 missense probably benign 0.01
R8048:Sh3bp1 UTSW 15 78910072 missense probably benign 0.26
R8887:Sh3bp1 UTSW 15 78904340 critical splice donor site probably null
Z1177:Sh3bp1 UTSW 15 78902572 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATGTTGAGGACCCACTGTG -3'
(R):5'- TGAGCAGGCATATTTGAGATGAC -3'

Sequencing Primer
(F):5'- TGTGGAAAGTGAAACTCCATCC -3'
(R):5'- CATATTTGAGATGACAGGGGAGGC -3'
Posted On2015-02-05