Mutagenetix > Incidental Mutation

Incidental Mutation 'R3054:Ltn1'

265099

Institutional Source

Beutler Lab

Gene Symbol

Ltn1

Ensembl Gene

ENSMUSG00000052299

Gene Name

listerin E3 ubiquitin protein ligase 1

Synonyms

4930528H02Rik, Rnf160, Zfp294, Listerin

MMRRC Submission

040563-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3054 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

87376651-87432612 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 87404073 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 1092 (A1092T)

Ref Sequence

ENSEMBL: ENSMUSP00000038775 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039449]

AlphaFold

Q6A009

Predicted Effect

probably benign
Transcript: ENSMUST00000039449
AA Change: A1092T

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000038775
Gene: ENSMUSG00000052299
AA Change: A1092T

Domain	Start	End	E-Value	Type
low complexity region	160	176	N/A	INTRINSIC
low complexity region	400	410	N/A	INTRINSIC
low complexity region	509	522	N/A	INTRINSIC
low complexity region	553	569	N/A	INTRINSIC
low complexity region	815	832	N/A	INTRINSIC
low complexity region	1380	1392	N/A	INTRINSIC
low complexity region	1427	1451	N/A	INTRINSIC
RING	1716	1762	1.05e-1	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Like most RING finger proteins, LTN1 functions as an E3 ubiquitin ligase (Chu et al., 2009 [PubMed 19196968]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality. Mice homozygous for a point mutation display progressive neuron degeneration and age dependent motor deficits. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730596B20Rik	A	T	6: 52,179,128		probably benign	Het
Aldh1l2	T	C	10: 83,502,472	K528E	probably benign	Het
Als2	A	G	1: 59,215,494	C235R	probably damaging	Het
Armc6	C	A	8: 70,225,149	V177L	probably benign	Het
Asb7	A	T	7: 66,679,211	V27D	probably damaging	Het
Bard1	A	G	1: 71,088,231	V73A	possibly damaging	Het
Ccdc150	A	G	1: 54,288,842	N361S	possibly damaging	Het
Cntn5	A	G	9: 10,419,071	L7P	probably benign	Het
Cst3	A	G	2: 148,872,031	S118P	probably damaging	Het
Cyp2a22	T	C	7: 26,938,829	D84G	probably damaging	Het
D330045A20Rik	T	A	X: 139,511,557	V439E	possibly damaging	Het
Ddo	A	G	10: 40,631,742	N45S	probably benign	Het
Drd4	T	C	7: 141,294,479	V319A	probably damaging	Het
Fat3	C	T	9: 15,960,496	R3533H	probably benign	Het
Fras1	A	T	5: 96,764,943	I3369F	probably damaging	Het
Gm5591	T	C	7: 38,520,634	S272G	probably benign	Het
Gm8444	A	T	15: 81,843,644		probably benign	Het
Gm9776	A	G	13: 94,358,650		probably benign	Het
Kdm1b	C	T	13: 47,063,077	R308W	probably damaging	Het
Larp1b	A	T	3: 40,964,100	I59F	probably benign	Het
Map1b	A	G	13: 99,432,742	V1157A	unknown	Het
Mboat1	A	T	13: 30,195,741	M92L	probably benign	Het
Meis3	G	T	7: 16,182,453	L284F	probably damaging	Het
Muc20	T	C	16: 32,779,029	F3317L	probably benign	Het
Muc5b	G	T	7: 141,864,041	V3575F	probably damaging	Het
Polr1e	C	T	4: 45,018,724	T18I	possibly damaging	Het
Ppp4r1	G	T	17: 65,836,079	A764S	probably damaging	Het
Psg29	A	G	7: 17,208,802	T243A	probably benign	Het
Ptprn2	T	C	12: 116,722,133	Y71H	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sh3bp1	C	T	15: 78,911,422	P584S	probably benign	Het
Slc4a4	T	C	5: 89,225,948	V971A	probably damaging	Het
Stil	T	A	4: 115,004,966	H35Q	probably damaging	Het
Strn	A	T	17: 78,682,892	V65D	probably damaging	Het
Sumf1	T	C	6: 108,153,204	N185D	probably benign	Het
Timm29	T	C	9: 21,593,591	M185T	probably damaging	Het
Tjp3	T	C	10: 81,280,507	K251R	probably benign	Het
Tubgcp6	A	T	15: 89,122,603	M72K	probably damaging	Het
Utp14b	T	A	1: 78,664,725	D113E	possibly damaging	Het
Vps13b	A	G	15: 35,646,361	E1537G	probably damaging	Het
Zfr	A	G	15: 12,154,507	N592S	probably damaging	Het

Other mutations in Ltn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00328:Ltn1	APN	16	87418490	missense	probably benign	0.03
IGL01139:Ltn1	APN	16	87416009	missense	probably benign	0.04
IGL01359:Ltn1	APN	16	87405693	splice site	probably benign
IGL01503:Ltn1	APN	16	87420807	critical splice donor site	probably benign
IGL01529:Ltn1	APN	16	87381471	missense	probably benign	0.00
IGL02437:Ltn1	APN	16	87398001	missense	probably benign	0.04
IGL02658:Ltn1	APN	16	87415774	missense	probably damaging	1.00
IGL02890:Ltn1	APN	16	87409297	splice site	probably null
IGL02899:Ltn1	APN	16	87382659	missense	probably benign	0.34
IGL02902:Ltn1	APN	16	87379805	missense	possibly damaging	0.70
IGL03128:Ltn1	APN	16	87415944	missense	probably benign	0.00
IGL03392:Ltn1	APN	16	87425611	missense	probably damaging	1.00
IGL03046:Ltn1	UTSW	16	87405621	missense	probably benign	0.10
PIT4305001:Ltn1	UTSW	16	87420323	missense	probably damaging	1.00
PIT4366001:Ltn1	UTSW	16	87380840	nonsense	probably null
R0126:Ltn1	UTSW	16	87425640	missense	probably benign	0.00
R0164:Ltn1	UTSW	16	87405519	splice site	probably benign
R0165:Ltn1	UTSW	16	87405519	splice site	probably benign
R0280:Ltn1	UTSW	16	87397838	missense	probably damaging	1.00
R0565:Ltn1	UTSW	16	87416010	missense	probably benign	0.01
R0733:Ltn1	UTSW	16	87412507	missense	probably benign	0.01
R1034:Ltn1	UTSW	16	87397137	splice site	probably null
R1252:Ltn1	UTSW	16	87416030	missense	probably benign	0.00
R1524:Ltn1	UTSW	16	87381556	missense	probably damaging	1.00
R1746:Ltn1	UTSW	16	87411781	missense	possibly damaging	0.86
R1826:Ltn1	UTSW	16	87415616	missense	probably damaging	1.00
R1831:Ltn1	UTSW	16	87400146	missense	possibly damaging	0.94
R1839:Ltn1	UTSW	16	87416264	nonsense	probably null
R1860:Ltn1	UTSW	16	87416343	missense	probably benign	0.06
R1997:Ltn1	UTSW	16	87381637	missense	probably damaging	1.00
R2109:Ltn1	UTSW	16	87415642	missense	probably benign	0.03
R2134:Ltn1	UTSW	16	87382713	missense	probably damaging	1.00
R2135:Ltn1	UTSW	16	87382713	missense	probably damaging	1.00
R2193:Ltn1	UTSW	16	87427647	missense	probably damaging	1.00
R2307:Ltn1	UTSW	16	87432424	critical splice donor site	probably null
R2376:Ltn1	UTSW	16	87420807	critical splice donor site	probably null
R3404:Ltn1	UTSW	16	87416215	missense	probably damaging	0.98
R3405:Ltn1	UTSW	16	87416215	missense	probably damaging	0.98
R3618:Ltn1	UTSW	16	87420899	missense	probably damaging	1.00
R4065:Ltn1	UTSW	16	87416230	missense	possibly damaging	0.84
R4066:Ltn1	UTSW	16	87416230	missense	possibly damaging	0.84
R4067:Ltn1	UTSW	16	87416230	missense	possibly damaging	0.84
R4288:Ltn1	UTSW	16	87397988	missense	possibly damaging	0.57
R4436:Ltn1	UTSW	16	87405614	missense	probably benign	0.17
R4535:Ltn1	UTSW	16	87426286	missense	probably damaging	1.00
R4581:Ltn1	UTSW	16	87402024	critical splice donor site	probably null
R4669:Ltn1	UTSW	16	87418487	missense	possibly damaging	0.90
R4715:Ltn1	UTSW	16	87418494	missense	probably damaging	0.98
R4830:Ltn1	UTSW	16	87379694	missense	probably damaging	1.00
R4887:Ltn1	UTSW	16	87398809	nonsense	probably null
R4961:Ltn1	UTSW	16	87397791	missense	probably benign
R4992:Ltn1	UTSW	16	87405587	missense	possibly damaging	0.70
R5073:Ltn1	UTSW	16	87427740	missense	probably damaging	0.99
R5288:Ltn1	UTSW	16	87416011	missense	possibly damaging	0.80
R5802:Ltn1	UTSW	16	87415681	missense	probably benign	0.17
R5907:Ltn1	UTSW	16	87381503	missense	possibly damaging	0.94
R6180:Ltn1	UTSW	16	87427789	missense	probably damaging	1.00
R6194:Ltn1	UTSW	16	87415810	missense	probably damaging	1.00
R6257:Ltn1	UTSW	16	87411774	missense	possibly damaging	0.74
R6301:Ltn1	UTSW	16	87420306	missense	probably benign
R6481:Ltn1	UTSW	16	87378980	missense	probably damaging	1.00
R6525:Ltn1	UTSW	16	87420186	missense	probably damaging	1.00
R6958:Ltn1	UTSW	16	87397791	missense	probably benign
R6969:Ltn1	UTSW	16	87415690	missense	probably damaging	1.00
R7002:Ltn1	UTSW	16	87423473	missense	probably benign
R7038:Ltn1	UTSW	16	87424871	missense	probably damaging	1.00
R7062:Ltn1	UTSW	16	87427603	missense	probably damaging	0.98
R7152:Ltn1	UTSW	16	87427641	missense	probably damaging	1.00
R7180:Ltn1	UTSW	16	87418494	missense	probably damaging	0.98
R7247:Ltn1	UTSW	16	87409387	missense	probably benign	0.00
R7454:Ltn1	UTSW	16	87397812	missense	probably benign	0.03
R7471:Ltn1	UTSW	16	87397899	missense	probably benign
R7511:Ltn1	UTSW	16	87408828	missense	possibly damaging	0.63
R7691:Ltn1	UTSW	16	87398686	missense	probably damaging	0.99
R7702:Ltn1	UTSW	16	87426278	missense	probably damaging	1.00
R7761:Ltn1	UTSW	16	87411793	missense	probably benign
R8002:Ltn1	UTSW	16	87415947	missense	probably benign	0.17
R8101:Ltn1	UTSW	16	87418497	missense	probably damaging	1.00
R8142:Ltn1	UTSW	16	87381641	missense	probably benign	0.21
R8214:Ltn1	UTSW	16	87380803	missense	probably benign	0.02
R8674:Ltn1	UTSW	16	87398785	missense	probably benign
R8783:Ltn1	UTSW	16	87410359	missense	probably benign	0.30
R8839:Ltn1	UTSW	16	87418502	missense	probably damaging	1.00
R8885:Ltn1	UTSW	16	87381545	missense	probably damaging	1.00
R8889:Ltn1	UTSW	16	87432342	intron	probably benign
R8892:Ltn1	UTSW	16	87432342	intron	probably benign
R8919:Ltn1	UTSW	16	87381493	missense	probably damaging	0.98
R8970:Ltn1	UTSW	16	87416038	missense	probably benign
R9113:Ltn1	UTSW	16	87427644	missense	probably damaging	1.00
R9206:Ltn1	UTSW	16	87400410	missense	probably benign	0.00
R9208:Ltn1	UTSW	16	87400410	missense	probably benign	0.00
R9234:Ltn1	UTSW	16	87397201	missense	probably damaging	0.98
R9421:Ltn1	UTSW	16	87418487	missense	possibly damaging	0.90
R9558:Ltn1	UTSW	16	87423407	missense	probably benign	0.05
R9654:Ltn1	UTSW	16	87410339	missense	probably benign	0.00
R9738:Ltn1	UTSW	16	87425636	missense	probably damaging	1.00
X0028:Ltn1	UTSW	16	87402134	missense	probably benign	0.01
Z1177:Ltn1	UTSW	16	87402037	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AATCCCCTCATTCCCAAACCTTG -3'
(R):5'- TACACTCCCTGTCCTTGGAT -3'

Sequencing Primer
(F):5'- TGGCCAAAGTAACCCACT -3'
(R):5'- ACTCCCTGTCCTTGGATAATTAGTGG -3'

Posted On

2015-02-05