Incidental Mutation 'R3054:Ppp4r1'
ID265101
Institutional Source Beutler Lab
Gene Symbol Ppp4r1
Ensembl Gene ENSMUSG00000061950
Gene Nameprotein phosphatase 4, regulatory subunit 1
SynonymsPp4r1, 3110001J10Rik
MMRRC Submission 040563-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3054 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location65782573-65841926 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 65836079 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 764 (A764S)
Ref Sequence ENSEMBL: ENSMUSP00000072848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073104] [ENSMUST00000160664] [ENSMUST00000162109] [ENSMUST00000162703]
Predicted Effect probably damaging
Transcript: ENSMUST00000073104
AA Change: A764S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000072848
Gene: ENSMUSG00000061950
AA Change: A764S

DomainStartEndE-ValueType
low complexity region 152 163 N/A INTRINSIC
Pfam:HEAT 213 244 2e-5 PFAM
Pfam:HEAT 253 280 2.7e-6 PFAM
low complexity region 531 540 N/A INTRINSIC
PDB:3FGA|A 664 930 3e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097293
Predicted Effect probably benign
Transcript: ENSMUST00000159646
SMART Domains Protein: ENSMUSP00000123796
Gene: ENSMUSG00000061950

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160664
AA Change: A747S

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124690
Gene: ENSMUSG00000061950
AA Change: A747S

DomainStartEndE-ValueType
low complexity region 135 146 N/A INTRINSIC
Pfam:HEAT 236 263 2.2e-6 PFAM
low complexity region 514 523 N/A INTRINSIC
PDB:3FGA|A 647 913 3e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000162109
SMART Domains Protein: ENSMUSP00000125220
Gene: ENSMUSG00000061950

DomainStartEndE-ValueType
low complexity region 152 163 N/A INTRINSIC
Pfam:HEAT 253 280 7.1e-7 PFAM
Pfam:HEAT 292 322 2.1e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182940
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of several alternate regulatory subunits of serine/threonine protein phosphatase 4 (PP4). The protein features multiple HEAT repeats. This protein forms a complex with PP4RC. This complex may have a distinct role from other PP4 complexes, including regulation of HDAC3 (Zhang et al., PMID: 15805470). There is also a transcribed pseudogene on chromosome 20. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik A T 6: 52,179,128 probably benign Het
Aldh1l2 T C 10: 83,502,472 K528E probably benign Het
Als2 A G 1: 59,215,494 C235R probably damaging Het
Armc6 C A 8: 70,225,149 V177L probably benign Het
Asb7 A T 7: 66,679,211 V27D probably damaging Het
Bard1 A G 1: 71,088,231 V73A possibly damaging Het
Ccdc150 A G 1: 54,288,842 N361S possibly damaging Het
Cntn5 A G 9: 10,419,071 L7P probably benign Het
Cst3 A G 2: 148,872,031 S118P probably damaging Het
Cyp2a22 T C 7: 26,938,829 D84G probably damaging Het
D330045A20Rik T A X: 139,511,557 V439E possibly damaging Het
Ddo A G 10: 40,631,742 N45S probably benign Het
Drd4 T C 7: 141,294,479 V319A probably damaging Het
Fat3 C T 9: 15,960,496 R3533H probably benign Het
Fras1 A T 5: 96,764,943 I3369F probably damaging Het
Gm5591 T C 7: 38,520,634 S272G probably benign Het
Gm8444 A T 15: 81,843,644 probably benign Het
Gm9776 A G 13: 94,358,650 probably benign Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Larp1b A T 3: 40,964,100 I59F probably benign Het
Ltn1 C T 16: 87,404,073 A1092T probably benign Het
Map1b A G 13: 99,432,742 V1157A unknown Het
Mboat1 A T 13: 30,195,741 M92L probably benign Het
Meis3 G T 7: 16,182,453 L284F probably damaging Het
Muc20 T C 16: 32,779,029 F3317L probably benign Het
Muc5b G T 7: 141,864,041 V3575F probably damaging Het
Polr1e C T 4: 45,018,724 T18I possibly damaging Het
Psg29 A G 7: 17,208,802 T243A probably benign Het
Ptprn2 T C 12: 116,722,133 Y71H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sh3bp1 C T 15: 78,911,422 P584S probably benign Het
Slc4a4 T C 5: 89,225,948 V971A probably damaging Het
Stil T A 4: 115,004,966 H35Q probably damaging Het
Strn A T 17: 78,682,892 V65D probably damaging Het
Sumf1 T C 6: 108,153,204 N185D probably benign Het
Timm29 T C 9: 21,593,591 M185T probably damaging Het
Tjp3 T C 10: 81,280,507 K251R probably benign Het
Tubgcp6 A T 15: 89,122,603 M72K probably damaging Het
Utp14b T A 1: 78,664,725 D113E possibly damaging Het
Vps13b A G 15: 35,646,361 E1537G probably damaging Het
Zfr A G 15: 12,154,507 N592S probably damaging Het
Other mutations in Ppp4r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Ppp4r1 APN 17 65816019 missense probably benign 0.06
IGL01415:Ppp4r1 APN 17 65813527 missense probably damaging 1.00
IGL02166:Ppp4r1 APN 17 65813492 missense probably benign 0.01
IGL02672:Ppp4r1 APN 17 65840947 missense probably damaging 1.00
estancia UTSW 17 65803968 critical splice donor site probably null
Hacienda UTSW 17 65816006 missense probably benign
R0304:Ppp4r1 UTSW 17 65816006 missense probably benign
R0976:Ppp4r1 UTSW 17 65841018 makesense probably null
R1355:Ppp4r1 UTSW 17 65840987 missense probably benign
R2356:Ppp4r1 UTSW 17 65833050 missense probably damaging 0.99
R2405:Ppp4r1 UTSW 17 65811346 missense possibly damaging 0.95
R4391:Ppp4r1 UTSW 17 65824754 missense probably benign 0.05
R4603:Ppp4r1 UTSW 17 65813464 missense probably damaging 1.00
R4763:Ppp4r1 UTSW 17 65835110 missense possibly damaging 0.90
R5571:Ppp4r1 UTSW 17 65803861 nonsense probably null
R5586:Ppp4r1 UTSW 17 65824568 missense probably benign 0.00
R5661:Ppp4r1 UTSW 17 65803968 critical splice donor site probably null
R5742:Ppp4r1 UTSW 17 65837746 missense probably damaging 0.97
R5971:Ppp4r1 UTSW 17 65814348 missense possibly damaging 0.89
R6079:Ppp4r1 UTSW 17 65814348 missense possibly damaging 0.89
R6138:Ppp4r1 UTSW 17 65814348 missense possibly damaging 0.89
R6303:Ppp4r1 UTSW 17 65824729 missense probably benign 0.10
R6684:Ppp4r1 UTSW 17 65824342 missense probably benign 0.00
R7058:Ppp4r1 UTSW 17 65829500 missense probably benign 0.00
R7397:Ppp4r1 UTSW 17 65837791 missense probably benign 0.28
R7448:Ppp4r1 UTSW 17 65840941 missense probably damaging 1.00
R7465:Ppp4r1 UTSW 17 65831020 nonsense probably null
R7528:Ppp4r1 UTSW 17 65813498 missense probably damaging 1.00
R7571:Ppp4r1 UTSW 17 65810616 missense possibly damaging 0.91
R7910:Ppp4r1 UTSW 17 65811303 missense probably benign 0.00
R7910:Ppp4r1 UTSW 17 65829399 missense probably damaging 1.00
R7972:Ppp4r1 UTSW 17 65833098 missense possibly damaging 0.90
U15987:Ppp4r1 UTSW 17 65814348 missense possibly damaging 0.89
Z1176:Ppp4r1 UTSW 17 65838926 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGAAATAGAGCTGCCATGTATC -3'
(R):5'- AAGGCCACCTGCAGTAACTC -3'

Sequencing Primer
(F):5'- ATAGAGCTGCCATGTATCTTTAGG -3'
(R):5'- TCAGCCACAGTGCATGGACAG -3'
Posted On2015-02-05