Incidental Mutation 'R3055:Ccdc150'
ID265105
Institutional Source Beutler Lab
Gene Symbol Ccdc150
Ensembl Gene ENSMUSG00000025983
Gene Namecoiled-coil domain containing 150
Synonyms4930511H11Rik
MMRRC Submission 040564-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R3055 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location54250683-54368727 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54288842 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 361 (N361S)
Ref Sequence ENSEMBL: ENSMUSP00000027128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027128] [ENSMUST00000160472]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027128
AA Change: N361S

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027128
Gene: ENSMUSG00000025983
AA Change: N361S

DomainStartEndE-ValueType
coiled coil region 160 250 N/A INTRINSIC
coiled coil region 288 314 N/A INTRINSIC
coiled coil region 418 676 N/A INTRINSIC
coiled coil region 727 952 N/A INTRINSIC
coiled coil region 985 1048 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160472
AA Change: N361S

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000125195
Gene: ENSMUSG00000025983
AA Change: N361S

DomainStartEndE-ValueType
coiled coil region 160 250 N/A INTRINSIC
coiled coil region 288 314 N/A INTRINSIC
coiled coil region 418 551 N/A INTRINSIC
Meta Mutation Damage Score 0.0696 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610042L04Rik A G 14: 4,348,878 E13G probably damaging Het
5730596B20Rik A T 6: 52,179,128 probably benign Het
A230050P20Rik AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA 9: 20,873,717 probably benign Het
Abca16 A G 7: 120,435,851 M287V probably benign Het
Abca7 G A 10: 79,999,747 R283H probably damaging Het
Acad11 A G 9: 104,076,336 I126V probably damaging Het
Ahrr A G 13: 74,224,887 V148A probably damaging Het
Aldh1l2 T C 10: 83,502,472 K528E probably benign Het
Atp6v0a2 T A 5: 124,627,144 probably benign Het
Atxn10 A G 15: 85,387,005 D248G probably benign Het
Bard1 A G 1: 71,088,231 V73A possibly damaging Het
Catsper3 T C 13: 55,808,896 S376P unknown Het
Cxcr6 A T 9: 123,810,464 I177F probably damaging Het
D330045A20Rik T A X: 139,511,557 V439E possibly damaging Het
Ddx25 A G 9: 35,551,351 V246A probably damaging Het
Drd4 T C 7: 141,294,479 V319A probably damaging Het
Dscam G A 16: 96,801,355 T629I probably damaging Het
Evi5l C T 8: 4,191,603 R311* probably null Het
Fxr1 A G 3: 34,049,184 E221G probably damaging Het
Gldn A T 9: 54,338,523 T453S probably damaging Het
Gm436 A G 4: 144,674,698 I72T probably benign Het
Ighm T A 12: 113,418,976 probably benign Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Lgr5 T A 10: 115,466,123 probably benign Het
Mier3 T A 13: 111,691,303 D7E probably damaging Het
Mms19 A T 19: 41,950,088 probably benign Het
Mrpl20 G T 4: 155,803,872 V43F possibly damaging Het
Muc5b G T 7: 141,864,041 V3575F probably damaging Het
Naip5 T C 13: 100,221,878 Y950C probably benign Het
Olfr1094 T C 2: 86,829,127 F125S possibly damaging Het
Olfr463 A G 11: 87,893,372 V184A possibly damaging Het
Olfr875 G T 9: 37,773,193 C178F probably damaging Het
Pkd1l2 T A 8: 117,068,315 probably null Het
Prune2 A G 19: 17,125,043 E2522G probably damaging Het
Radil T C 5: 142,495,406 T549A possibly damaging Het
Rasa2 G A 9: 96,611,473 L53F possibly damaging Het
Rasgrf2 A G 13: 92,029,075 F306L probably damaging Het
Rbm19 C T 5: 120,133,010 R633C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc4a4 T A 5: 89,132,507 L353H probably damaging Het
Slc4a4 T C 5: 89,225,948 V971A probably damaging Het
Stil T A 4: 115,014,069 probably benign Het
Tjp3 T C 10: 81,280,507 K251R probably benign Het
Ugt2b35 A T 5: 87,001,598 Y236F probably benign Het
Utp14b T A 1: 78,664,725 D113E possibly damaging Het
Vmn1r121 G A 7: 21,098,465 Q17* probably null Het
Vmn2r28 A T 7: 5,481,392 L603Q probably damaging Het
Vps13b A G 15: 35,646,361 E1537G probably damaging Het
Xrcc4 T C 13: 90,062,077 T83A probably benign Het
Yae1d1 T C 13: 17,993,242 E22G probably damaging Het
Other mutations in Ccdc150
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00712:Ccdc150 APN 1 54272550 splice site probably benign
IGL00819:Ccdc150 APN 1 54263573 missense probably damaging 1.00
IGL01973:Ccdc150 APN 1 54300488 splice site probably null
IGL02352:Ccdc150 APN 1 54272521 missense probably benign 0.25
IGL02359:Ccdc150 APN 1 54272521 missense probably benign 0.25
IGL02620:Ccdc150 APN 1 54263545 nonsense probably null
IGL02673:Ccdc150 APN 1 54328990 missense probably benign 0.09
IGL03148:Ccdc150 APN 1 54278715 missense possibly damaging 0.68
IGL03185:Ccdc150 APN 1 54300323 missense probably damaging 1.00
IGL03014:Ccdc150 UTSW 1 54290702 missense probably damaging 0.99
R0066:Ccdc150 UTSW 1 54356691 missense probably benign
R0066:Ccdc150 UTSW 1 54356691 missense probably benign
R0217:Ccdc150 UTSW 1 54300430 missense possibly damaging 0.87
R0582:Ccdc150 UTSW 1 54329511 missense probably benign
R0687:Ccdc150 UTSW 1 54285631 splice site probably null
R0790:Ccdc150 UTSW 1 54277776 splice site probably benign
R1146:Ccdc150 UTSW 1 54364971 splice site probably benign
R1288:Ccdc150 UTSW 1 54364458 missense probably damaging 1.00
R1763:Ccdc150 UTSW 1 54354636 missense probably benign 0.42
R1855:Ccdc150 UTSW 1 54367910 intron probably benign
R1957:Ccdc150 UTSW 1 54263909 missense probably benign 0.00
R2180:Ccdc150 UTSW 1 54272547 critical splice donor site probably null
R2226:Ccdc150 UTSW 1 54364925 missense probably null 0.11
R3054:Ccdc150 UTSW 1 54288842 missense possibly damaging 0.51
R3056:Ccdc150 UTSW 1 54288842 missense possibly damaging 0.51
R3409:Ccdc150 UTSW 1 54356773 missense probably benign 0.02
R3411:Ccdc150 UTSW 1 54356773 missense probably benign 0.02
R3812:Ccdc150 UTSW 1 54368310 missense probably benign 0.00
R4031:Ccdc150 UTSW 1 54278811 missense probably benign 0.31
R4356:Ccdc150 UTSW 1 54353054 missense probably damaging 0.98
R4617:Ccdc150 UTSW 1 54355754 missense probably benign 0.00
R4757:Ccdc150 UTSW 1 54278715 missense possibly damaging 0.81
R4957:Ccdc150 UTSW 1 54364868 intron probably benign
R5028:Ccdc150 UTSW 1 54263477 missense probably benign 0.01
R5512:Ccdc150 UTSW 1 54354647 missense probably damaging 0.96
R5757:Ccdc150 UTSW 1 54263620 missense probably damaging 1.00
R5943:Ccdc150 UTSW 1 54300367 missense probably benign 0.01
R5948:Ccdc150 UTSW 1 54277714 missense possibly damaging 0.79
R6033:Ccdc150 UTSW 1 54285628 critical splice donor site probably null
R6033:Ccdc150 UTSW 1 54285628 critical splice donor site probably null
R6065:Ccdc150 UTSW 1 54263599 missense possibly damaging 0.90
R6390:Ccdc150 UTSW 1 54368017 missense probably benign 0.01
R6399:Ccdc150 UTSW 1 54263957 splice site probably null
R6988:Ccdc150 UTSW 1 54355709 nonsense probably null
R7248:Ccdc150 UTSW 1 54304898 missense probably benign 0.00
R7319:Ccdc150 UTSW 1 54263337 intron probably null
R7322:Ccdc150 UTSW 1 54259966 missense probably benign 0.01
R7366:Ccdc150 UTSW 1 54300382 nonsense probably null
R7647:Ccdc150 UTSW 1 54356704 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTTCCATGATCAATAACTCATAGG -3'
(R):5'- GAGTTCAGCATGCGATAAATGAAAC -3'

Sequencing Primer
(F):5'- AGGAAGGTTTTGAAAGTAGTTTAGAC -3'
(R):5'- GCATGCGATAAATGAAACTGTTTTG -3'
Posted On2015-02-05