Incidental Mutation 'I1329:Dlst'
ID26511
Institutional Source Beutler Lab
Gene Symbol Dlst
Ensembl Gene ENSMUSG00000004789
Gene Namedihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex)
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #I1329 (G1) of strain toku
Quality Score225
Status Validated (trace)
Chromosome12
Chromosomal Location85110833-85134845 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85123841 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 248 (M248T)
Ref Sequence ENSEMBL: ENSMUSP00000152664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053811] [ENSMUST00000221357] [ENSMUST00000223332]
Predicted Effect probably damaging
Transcript: ENSMUST00000053811
AA Change: M248T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000060346
Gene: ENSMUSG00000004789
AA Change: M248T

DomainStartEndE-ValueType
Pfam:Biotin_lipoyl 72 144 1.7e-22 PFAM
low complexity region 149 180 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
low complexity region 205 217 N/A INTRINSIC
Pfam:2-oxoacid_dh 221 452 2.3e-82 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221288
Predicted Effect probably damaging
Transcript: ENSMUST00000221357
AA Change: M248T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221842
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222998
Predicted Effect probably benign
Transcript: ENSMUST00000223332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223413
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223438
Meta Mutation Damage Score 0.6874 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 95.2%
Validation Efficiency 89% (42/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial protein that belongs to the 2-oxoacid dehydrogenase family. This protein is one of the three components (the E2 component) of the 2-oxoglutarate dehydrogenase complex that catalyzes the overall conversion of 2-oxoglutarate to succinyl-CoA and CO(2). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice heterozygous for a gene trap allele exhibit an accelerates amyloid pathology and memory deficit in a transgenic mouse model of amyloid deposition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,245,194 S542P probably benign Het
Adamts13 T C 2: 26,973,619 I28T possibly damaging Het
Agbl4 T A 4: 110,478,455 probably benign Het
Aspscr1 G C 11: 120,701,240 V268L probably damaging Het
Btbd10 A G 7: 113,332,875 S115P probably benign Het
Cercam T A 2: 29,871,085 V132E probably damaging Het
Decr1 G A 4: 15,930,976 R119* probably null Het
Erbb3 T C 10: 128,583,454 N215S possibly damaging Het
Flnc G A 6: 29,451,415 V1543M probably damaging Het
Gk5 GCC GC 9: 96,140,629 probably null Het
Glrb T A 3: 80,862,074 R115S probably damaging Het
Gm5592 T A 7: 41,286,354 Y93* probably null Het
Gpr20 C T 15: 73,695,763 R259H probably damaging Het
Il1rap A G 16: 26,692,850 T215A probably benign Het
Ipmk T C 10: 71,381,447 C275R possibly damaging Het
Lats1 A G 10: 7,712,802 N1061S probably benign Het
Nkain3 A G 4: 20,158,329 probably benign Het
Nr1h4 A G 10: 89,483,362 probably benign Het
Nr4a3 A G 4: 48,051,585 Q142R probably benign Het
Otog G A 7: 46,246,503 V131I probably benign Het
Parp12 A T 6: 39,087,571 M627K probably damaging Het
Pcdh9 A G 14: 93,886,209 S842P probably benign Het
Phc2 G C 4: 128,711,113 G214A probably damaging Het
Prpf40a C A 2: 53,176,395 V92L probably benign Het
Qser1 A T 2: 104,786,977 Y1163* probably null Het
Rpe65 A G 3: 159,624,723 D509G probably benign Het
Scin T A 12: 40,073,330 N518I probably damaging Het
Sfswap G T 5: 129,507,137 probably benign Het
Tfpi A T 2: 84,444,116 N182K possibly damaging Het
Tph1 A G 7: 46,650,013 L368P probably damaging Het
Ttn T C 2: 76,741,572 T26326A possibly damaging Het
Ubr1 G A 2: 120,934,294 probably benign Het
Usf3 G T 16: 44,220,530 C1791F probably damaging Het
Vmn1r16 T G 6: 57,323,534 R34S probably damaging Het
Ylpm1 C A 12: 85,040,880 P1604Q probably damaging Het
Zc3h12a A G 4: 125,119,364 V569A possibly damaging Het
Zmynd8 A G 2: 165,828,225 F488S probably damaging Het
Other mutations in Dlst
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02120:Dlst APN 12 85118568 missense probably benign 0.01
IGL02150:Dlst APN 12 85131033 missense possibly damaging 0.91
IGL02223:Dlst APN 12 85130918 missense probably benign 0.13
R0331:Dlst UTSW 12 85118812 missense probably damaging 1.00
R1087:Dlst UTSW 12 85132639 missense probably damaging 1.00
R1218:Dlst UTSW 12 85123864 missense probably damaging 1.00
R3901:Dlst UTSW 12 85132691 missense possibly damaging 0.55
R4705:Dlst UTSW 12 85118842 splice site probably null
R5457:Dlst UTSW 12 85122140 critical splice donor site probably null
R6039:Dlst UTSW 12 85118890 splice site probably null
R6039:Dlst UTSW 12 85118890 splice site probably null
R6422:Dlst UTSW 12 85130885 splice site probably null
R7078:Dlst UTSW 12 85110931 missense probably benign 0.03
R7366:Dlst UTSW 12 85128315 missense probably benign
R7900:Dlst UTSW 12 85130518 missense probably benign 0.00
Z1177:Dlst UTSW 12 85110893 utr 5 prime probably benign
Predicted Primers PCR Primer
(F):5'- ACTCCAGAAAGGGAAAGCCTCTAGC -3'
(R):5'- GCAAATTAAGCCAGTGGGTCATGC -3'

Sequencing Primer
(F):5'- tttaggaggtagaggcggg -3'
(R):5'- TCATGCTGTATAAGTCAGCAAGG -3'
Posted On2013-04-16