Incidental Mutation 'R3055:Stil'
ID265113
Institutional Source Beutler Lab
Gene Symbol Stil
Ensembl Gene ENSMUSG00000028718
Gene NameScl/Tal1 interrupting locus
SynonymsSil
MMRRC Submission 040564-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3055 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location115000159-115043196 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 115014069 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030490] [ENSMUST00000129957] [ENSMUST00000141933] [ENSMUST00000147519]
Predicted Effect probably benign
Transcript: ENSMUST00000030490
SMART Domains Protein: ENSMUSP00000030490
Gene: ENSMUSG00000028718

DomainStartEndE-ValueType
Pfam:STIL_N 22 426 5.1e-199 PFAM
low complexity region 709 724 N/A INTRINSIC
low complexity region 1106 1118 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129957
SMART Domains Protein: ENSMUSP00000123385
Gene: ENSMUSG00000028718

DomainStartEndE-ValueType
Pfam:STIL_N 22 416 1.5e-180 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130401
Predicted Effect probably benign
Transcript: ENSMUST00000141933
SMART Domains Protein: ENSMUSP00000118849
Gene: ENSMUSG00000028718

DomainStartEndE-ValueType
Pfam:STIL_N 22 392 6.6e-166 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144316
Predicted Effect probably benign
Transcript: ENSMUST00000147519
SMART Domains Protein: ENSMUSP00000120836
Gene: ENSMUSG00000028718

DomainStartEndE-ValueType
Pfam:STIL_N 1 78 5.3e-34 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: This gene encodes a centrosomal protein ubiquitously expressed in proliferating cells and during early embryonic development. Mice lacking the encoded protein die in utero with marked growth retardation, defects in the developing neural fold and randomization of left-right asymmetry. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos with various neural tube defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610042L04Rik A G 14: 4,348,878 E13G probably damaging Het
5730596B20Rik A T 6: 52,179,128 probably benign Het
A230050P20Rik AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA 9: 20,873,717 probably benign Het
Abca16 A G 7: 120,435,851 M287V probably benign Het
Abca7 G A 10: 79,999,747 R283H probably damaging Het
Acad11 A G 9: 104,076,336 I126V probably damaging Het
Ahrr A G 13: 74,224,887 V148A probably damaging Het
Aldh1l2 T C 10: 83,502,472 K528E probably benign Het
Atp6v0a2 T A 5: 124,627,144 probably benign Het
Atxn10 A G 15: 85,387,005 D248G probably benign Het
Bard1 A G 1: 71,088,231 V73A possibly damaging Het
Catsper3 T C 13: 55,808,896 S376P unknown Het
Ccdc150 A G 1: 54,288,842 N361S possibly damaging Het
Cxcr6 A T 9: 123,810,464 I177F probably damaging Het
D330045A20Rik T A X: 139,511,557 V439E possibly damaging Het
Ddx25 A G 9: 35,551,351 V246A probably damaging Het
Drd4 T C 7: 141,294,479 V319A probably damaging Het
Dscam G A 16: 96,801,355 T629I probably damaging Het
Evi5l C T 8: 4,191,603 R311* probably null Het
Fxr1 A G 3: 34,049,184 E221G probably damaging Het
Gldn A T 9: 54,338,523 T453S probably damaging Het
Gm436 A G 4: 144,674,698 I72T probably benign Het
Ighm T A 12: 113,418,976 probably benign Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Lgr5 T A 10: 115,466,123 probably benign Het
Mier3 T A 13: 111,691,303 D7E probably damaging Het
Mms19 A T 19: 41,950,088 probably benign Het
Mrpl20 G T 4: 155,803,872 V43F possibly damaging Het
Muc5b G T 7: 141,864,041 V3575F probably damaging Het
Naip5 T C 13: 100,221,878 Y950C probably benign Het
Olfr1094 T C 2: 86,829,127 F125S possibly damaging Het
Olfr463 A G 11: 87,893,372 V184A possibly damaging Het
Olfr875 G T 9: 37,773,193 C178F probably damaging Het
Pkd1l2 T A 8: 117,068,315 probably null Het
Prune2 A G 19: 17,125,043 E2522G probably damaging Het
Radil T C 5: 142,495,406 T549A possibly damaging Het
Rasa2 G A 9: 96,611,473 L53F possibly damaging Het
Rasgrf2 A G 13: 92,029,075 F306L probably damaging Het
Rbm19 C T 5: 120,133,010 R633C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc4a4 T A 5: 89,132,507 L353H probably damaging Het
Slc4a4 T C 5: 89,225,948 V971A probably damaging Het
Tjp3 T C 10: 81,280,507 K251R probably benign Het
Ugt2b35 A T 5: 87,001,598 Y236F probably benign Het
Utp14b T A 1: 78,664,725 D113E possibly damaging Het
Vmn1r121 G A 7: 21,098,465 Q17* probably null Het
Vmn2r28 A T 7: 5,481,392 L603Q probably damaging Het
Vps13b A G 15: 35,646,361 E1537G probably damaging Het
Xrcc4 T C 13: 90,062,077 T83A probably benign Het
Yae1d1 T C 13: 17,993,242 E22G probably damaging Het
Other mutations in Stil
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01506:Stil APN 4 115024112 missense probably benign 0.29
IGL01672:Stil APN 4 115032789 missense probably damaging 1.00
IGL02058:Stil APN 4 115014162 missense probably benign 0.00
IGL02076:Stil APN 4 115023637 missense probably benign 0.03
IGL02104:Stil APN 4 115041482 missense probably damaging 1.00
IGL02355:Stil APN 4 115010111 missense probably damaging 1.00
IGL02362:Stil APN 4 115010111 missense probably damaging 1.00
IGL02612:Stil APN 4 115023696 missense possibly damaging 0.80
IGL02695:Stil APN 4 115016175 missense probably damaging 1.00
IGL02696:Stil APN 4 115041495 missense probably damaging 0.99
IGL02826:Stil APN 4 115024098 missense probably benign 0.01
IGL02946:Stil APN 4 115029913 missense probably benign 0.05
IGL03146:Stil APN 4 115024415 missense probably damaging 1.00
BB005:Stil UTSW 4 115030001 missense probably damaging 0.98
BB015:Stil UTSW 4 115030001 missense probably damaging 0.98
R0058:Stil UTSW 4 115041298 missense probably damaging 1.00
R0256:Stil UTSW 4 115023685 missense possibly damaging 0.80
R0324:Stil UTSW 4 115039149 missense probably benign 0.01
R0391:Stil UTSW 4 115041172 critical splice acceptor site probably null
R0602:Stil UTSW 4 115024423 splice site probably benign
R0620:Stil UTSW 4 115007159 missense possibly damaging 0.52
R1452:Stil UTSW 4 115039195 missense probably benign 0.00
R1462:Stil UTSW 4 115023964 missense probably benign 0.00
R1462:Stil UTSW 4 115023964 missense probably benign 0.00
R1544:Stil UTSW 4 115023852 missense probably damaging 0.97
R1789:Stil UTSW 4 115041782 missense probably benign 0.01
R1878:Stil UTSW 4 115041226 missense probably damaging 1.00
R1895:Stil UTSW 4 115023875 missense probably benign 0.40
R2325:Stil UTSW 4 115032707 missense probably benign 0.12
R2401:Stil UTSW 4 115016286 missense probably null 0.81
R3054:Stil UTSW 4 115004966 missense probably damaging 1.00
R4097:Stil UTSW 4 115023600 missense probably benign 0.04
R4330:Stil UTSW 4 115004979 missense probably damaging 1.00
R4418:Stil UTSW 4 115009377 missense probably benign 0.17
R4665:Stil UTSW 4 115041644 missense probably benign 0.00
R4688:Stil UTSW 4 115041308 missense probably damaging 1.00
R4740:Stil UTSW 4 115006782 missense probably benign 0.15
R4860:Stil UTSW 4 115038474 missense probably benign 0.01
R4860:Stil UTSW 4 115038474 missense probably benign 0.01
R4909:Stil UTSW 4 115024225 nonsense probably null
R6130:Stil UTSW 4 115029861 splice site probably null
R6523:Stil UTSW 4 115032714 frame shift probably null
R7294:Stil UTSW 4 115007283 missense probably benign 0.17
R7357:Stil UTSW 4 115014226 critical splice donor site probably null
R7387:Stil UTSW 4 115024036 missense probably benign 0.37
R7592:Stil UTSW 4 115023808 missense probably benign 0.00
R7776:Stil UTSW 4 115032838 missense possibly damaging 0.49
R7908:Stil UTSW 4 115032699 missense possibly damaging 0.68
R7928:Stil UTSW 4 115030001 missense probably damaging 0.98
Z1088:Stil UTSW 4 115006693 missense probably damaging 1.00
Z1177:Stil UTSW 4 115041379 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGATGTGCATACCATTGTGTG -3'
(R):5'- ACAGGTAGCATAAGCACTTACATTG -3'

Sequencing Primer
(F):5'- GCTGACTGCACTTACAGAGAGTTC -3'
(R):5'- GAAAAGATGCAAAGTCTCCTTGTTGG -3'
Posted On2015-02-05