Incidental Mutation 'R3055:Mrpl20'
ID265115
Institutional Source Beutler Lab
Gene Symbol Mrpl20
Ensembl Gene ENSMUSG00000029066
Gene Namemitochondrial ribosomal protein L20
Synonyms2610008D01Rik, 4930425I20Rik
MMRRC Submission 040564-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R3055 (G1)
Quality Score206
Status Validated
Chromosome4
Chromosomal Location155802878-155809975 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 155803872 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 43 (V43F)
Ref Sequence ENSEMBL: ENSMUSP00000139007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030942] [ENSMUST00000105593] [ENSMUST00000130188] [ENSMUST00000137487] [ENSMUST00000185148]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030942
AA Change: V43F

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030942
Gene: ENSMUSG00000029066
AA Change: V43F

DomainStartEndE-ValueType
Pfam:Ribosomal_L20 11 116 2.3e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105593
SMART Domains Protein: ENSMUSP00000101218
Gene: ENSMUSG00000078487

DomainStartEndE-ValueType
ANK 32 61 2.32e2 SMART
ANK 65 94 1.31e-4 SMART
ANK 98 127 2.16e-5 SMART
ANK 165 195 2.47e0 SMART
low complexity region 205 215 N/A INTRINSIC
low complexity region 225 237 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000130188
AA Change: V43F

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139007
Gene: ENSMUSG00000029066
AA Change: V43F

DomainStartEndE-ValueType
Pfam:Ribosomal_L20 10 94 6.3e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000137487
AA Change: V43F

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139122
Gene: ENSMUSG00000029066
AA Change: V43F

DomainStartEndE-ValueType
Pfam:Ribosomal_L20 10 116 1.3e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184339
Predicted Effect probably benign
Transcript: ENSMUST00000185148
SMART Domains Protein: ENSMUSP00000139169
Gene: ENSMUSG00000029066

DomainStartEndE-ValueType
Pfam:Ribosomal_L20 10 79 1.5e-21 PFAM
Meta Mutation Damage Score 0.1136 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. A pseudogene corresponding to this gene is found on chromosome 21q. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610042L04Rik A G 14: 4,348,878 E13G probably damaging Het
5730596B20Rik A T 6: 52,179,128 probably benign Het
A230050P20Rik AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA 9: 20,873,717 probably benign Het
Abca16 A G 7: 120,435,851 M287V probably benign Het
Abca7 G A 10: 79,999,747 R283H probably damaging Het
Acad11 A G 9: 104,076,336 I126V probably damaging Het
Ahrr A G 13: 74,224,887 V148A probably damaging Het
Aldh1l2 T C 10: 83,502,472 K528E probably benign Het
Atp6v0a2 T A 5: 124,627,144 probably benign Het
Atxn10 A G 15: 85,387,005 D248G probably benign Het
Bard1 A G 1: 71,088,231 V73A possibly damaging Het
Catsper3 T C 13: 55,808,896 S376P unknown Het
Ccdc150 A G 1: 54,288,842 N361S possibly damaging Het
Cxcr6 A T 9: 123,810,464 I177F probably damaging Het
D330045A20Rik T A X: 139,511,557 V439E possibly damaging Het
Ddx25 A G 9: 35,551,351 V246A probably damaging Het
Drd4 T C 7: 141,294,479 V319A probably damaging Het
Dscam G A 16: 96,801,355 T629I probably damaging Het
Evi5l C T 8: 4,191,603 R311* probably null Het
Fxr1 A G 3: 34,049,184 E221G probably damaging Het
Gldn A T 9: 54,338,523 T453S probably damaging Het
Gm436 A G 4: 144,674,698 I72T probably benign Het
Ighm T A 12: 113,418,976 probably benign Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Lgr5 T A 10: 115,466,123 probably benign Het
Mier3 T A 13: 111,691,303 D7E probably damaging Het
Mms19 A T 19: 41,950,088 probably benign Het
Muc5b G T 7: 141,864,041 V3575F probably damaging Het
Naip5 T C 13: 100,221,878 Y950C probably benign Het
Olfr1094 T C 2: 86,829,127 F125S possibly damaging Het
Olfr463 A G 11: 87,893,372 V184A possibly damaging Het
Olfr875 G T 9: 37,773,193 C178F probably damaging Het
Pkd1l2 T A 8: 117,068,315 probably null Het
Prune2 A G 19: 17,125,043 E2522G probably damaging Het
Radil T C 5: 142,495,406 T549A possibly damaging Het
Rasa2 G A 9: 96,611,473 L53F possibly damaging Het
Rasgrf2 A G 13: 92,029,075 F306L probably damaging Het
Rbm19 C T 5: 120,133,010 R633C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc4a4 T A 5: 89,132,507 L353H probably damaging Het
Slc4a4 T C 5: 89,225,948 V971A probably damaging Het
Stil T A 4: 115,014,069 probably benign Het
Tjp3 T C 10: 81,280,507 K251R probably benign Het
Ugt2b35 A T 5: 87,001,598 Y236F probably benign Het
Utp14b T A 1: 78,664,725 D113E possibly damaging Het
Vmn1r121 G A 7: 21,098,465 Q17* probably null Het
Vmn2r28 A T 7: 5,481,392 L603Q probably damaging Het
Vps13b A G 15: 35,646,361 E1537G probably damaging Het
Xrcc4 T C 13: 90,062,077 T83A probably benign Het
Yae1d1 T C 13: 17,993,242 E22G probably damaging Het
Other mutations in Mrpl20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00674:Mrpl20 APN 4 155808584 missense probably benign 0.00
R3056:Mrpl20 UTSW 4 155803872 missense possibly damaging 0.89
R4082:Mrpl20 UTSW 4 155808513 missense probably damaging 0.99
R4846:Mrpl20 UTSW 4 155808536 missense possibly damaging 0.85
R5305:Mrpl20 UTSW 4 155803705 missense probably damaging 1.00
R5779:Mrpl20 UTSW 4 155806921 missense probably damaging 1.00
R6576:Mrpl20 UTSW 4 155806914 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ATCATGGTCTTCCTCACGACG -3'
(R):5'- GCTACAGAAGGCTAAGCTCC -3'

Sequencing Primer
(F):5'- GGAACCGCCTCACCGATC -3'
(R):5'- TAAGCTCCGGGGGCATG -3'
Posted On2015-02-05