Mutagenetix > Incidental Mutation

Incidental Mutation 'R3055:Slc4a4'

265117

Institutional Source

Beutler Lab

Gene Symbol

Slc4a4

Ensembl Gene

ENSMUSG00000060961

Gene Name

solute carrier family 4 (anion exchanger), member 4

Synonyms

NBC1, NBC

MMRRC Submission

040564-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3055 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

88886818-89239653 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 89132507 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Histidine at position 353 (L353H)

Ref Sequence

ENSEMBL: ENSMUSP00000118413 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113218] [ENSMUST00000130041] [ENSMUST00000148750] [ENSMUST00000156238]

AlphaFold

O88343

Predicted Effect

probably damaging
Transcript: ENSMUST00000113218
AA Change: L388H

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000108844
Gene: ENSMUSG00000060961
AA Change: L388H

Domain	Start	End	E-Value	Type
low complexity region	40	59	N/A	INTRINSIC
low complexity region	76	87	N/A	INTRINSIC
Pfam:Band_3_cyto	137	379	1.1e-100	PFAM
low complexity region	408	423	N/A	INTRINSIC
Pfam:HCO3_cotransp	426	947	3e-246	PFAM
transmembrane domain	953	975	N/A	INTRINSIC
low complexity region	999	1015	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000130041
AA Change: L353H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000118413
Gene: ENSMUSG00000060961
AA Change: L353H

Domain	Start	End	E-Value	Type
Pfam:Band_3_cyto	93	344	1.5e-101	PFAM
low complexity region	373	388	N/A	INTRINSIC
Pfam:HCO3_cotransp	391	912	2.7e-246	PFAM
transmembrane domain	918	940	N/A	INTRINSIC
low complexity region	964	980	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000148750
AA Change: L397H

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000119325
Gene: ENSMUSG00000060961
AA Change: L397H

Domain	Start	End	E-Value	Type
low complexity region	40	59	N/A	INTRINSIC
low complexity region	76	87	N/A	INTRINSIC
Pfam:Band_3_cyto	137	388	3.7e-101	PFAM
low complexity region	417	432	N/A	INTRINSIC
Pfam:HCO3_cotransp	435	956	7.3e-246	PFAM
transmembrane domain	962	984	N/A	INTRINSIC
low complexity region	1008	1024	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000156238
AA Change: L397H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000121744
Gene: ENSMUSG00000060961
AA Change: L397H

Domain	Start	End	E-Value	Type
low complexity region	40	59	N/A	INTRINSIC
low complexity region	76	87	N/A	INTRINSIC
Pfam:Band_3_cyto	137	388	4.6e-101	PFAM
low complexity region	417	432	N/A	INTRINSIC
Pfam:HCO3_cotransp	436	956	4.1e-231	PFAM
transmembrane domain	962	984	N/A	INTRINSIC
low complexity region	1008	1024	N/A	INTRINSIC

Meta Mutation Damage Score

0.2338

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium bicarbonate cotransporter (NBC) involved in the regulation of bicarbonate secretion and absorption and intracellular pH. Mutations in this gene are associated with proximal renal tubular acidosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit smaller birth size, growth retardation, postnatal lethality, bowel obstructions, altered blood chemistry, acidosis, spleen defects and defects in ion homeostasis. Heterozygotes have decreased levels of circulating bicarbonate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610042L04Rik	A	G	14: 4,348,878	E13G	probably damaging	Het
5730596B20Rik	A	T	6: 52,179,128		probably benign	Het
A230050P20Rik	AGAGGAGGAGGAGGAGGAGGAGGAGGA	AGAGGAGGAGGAGGAGGAGGAGGA	9: 20,873,717		probably benign	Het
Abca16	A	G	7: 120,435,851	M287V	probably benign	Het
Abca7	G	A	10: 79,999,747	R283H	probably damaging	Het
Acad11	A	G	9: 104,076,336	I126V	probably damaging	Het
Ahrr	A	G	13: 74,224,887	V148A	probably damaging	Het
Aldh1l2	T	C	10: 83,502,472	K528E	probably benign	Het
Atp6v0a2	T	A	5: 124,627,144		probably benign	Het
Atxn10	A	G	15: 85,387,005	D248G	probably benign	Het
Bard1	A	G	1: 71,088,231	V73A	possibly damaging	Het
Catsper3	T	C	13: 55,808,896	S376P	unknown	Het
Ccdc150	A	G	1: 54,288,842	N361S	possibly damaging	Het
Cxcr6	A	T	9: 123,810,464	I177F	probably damaging	Het
D330045A20Rik	T	A	X: 139,511,557	V439E	possibly damaging	Het
Ddx25	A	G	9: 35,551,351	V246A	probably damaging	Het
Drd4	T	C	7: 141,294,479	V319A	probably damaging	Het
Dscam	G	A	16: 96,801,355	T629I	probably damaging	Het
Evi5l	C	T	8: 4,191,603	R311*	probably null	Het
Fxr1	A	G	3: 34,049,184	E221G	probably damaging	Het
Gldn	A	T	9: 54,338,523	T453S	probably damaging	Het
Gm436	A	G	4: 144,674,698	I72T	probably benign	Het
Ighm	T	A	12: 113,418,976		probably benign	Het
Ints12	G	A	3: 133,109,365	M444I	possibly damaging	Het
Lgr5	T	A	10: 115,466,123		probably benign	Het
Mier3	T	A	13: 111,691,303	D7E	probably damaging	Het
Mms19	A	T	19: 41,950,088		probably benign	Het
Mrpl20	G	T	4: 155,803,872	V43F	possibly damaging	Het
Muc5b	G	T	7: 141,864,041	V3575F	probably damaging	Het
Naip5	T	C	13: 100,221,878	Y950C	probably benign	Het
Olfr1094	T	C	2: 86,829,127	F125S	possibly damaging	Het
Olfr463	A	G	11: 87,893,372	V184A	possibly damaging	Het
Olfr875	G	T	9: 37,773,193	C178F	probably damaging	Het
Pkd1l2	T	A	8: 117,068,315		probably null	Het
Prune2	A	G	19: 17,125,043	E2522G	probably damaging	Het
Radil	T	C	5: 142,495,406	T549A	possibly damaging	Het
Rasa2	G	A	9: 96,611,473	L53F	possibly damaging	Het
Rasgrf2	A	G	13: 92,029,075	F306L	probably damaging	Het
Rbm19	C	T	5: 120,133,010	R633C	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Stil	T	A	4: 115,014,069		probably benign	Het
Tjp3	T	C	10: 81,280,507	K251R	probably benign	Het
Ugt2b35	A	T	5: 87,001,598	Y236F	probably benign	Het
Utp14b	T	A	1: 78,664,725	D113E	possibly damaging	Het
Vmn1r121	G	A	7: 21,098,465	Q17*	probably null	Het
Vmn2r28	A	T	7: 5,481,392	L603Q	probably damaging	Het
Vps13b	A	G	15: 35,646,361	E1537G	probably damaging	Het
Xrcc4	T	C	13: 90,062,077	T83A	probably benign	Het
Yae1d1	T	C	13: 17,993,242	E22G	probably damaging	Het

Other mutations in Slc4a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00827:Slc4a4	APN	5	89179686	missense	probably benign	0.01
IGL00976:Slc4a4	APN	5	88954798	missense	probably damaging	1.00
IGL01074:Slc4a4	APN	5	89179774	missense	probably damaging	1.00
IGL01120:Slc4a4	APN	5	89132379	missense	probably damaging	1.00
IGL01284:Slc4a4	APN	5	89129673	missense	probably benign	0.22
IGL01375:Slc4a4	APN	5	89179734	missense	probably damaging	1.00
IGL01399:Slc4a4	APN	5	89228935	missense	probably damaging	1.00
IGL01487:Slc4a4	APN	5	89228856	missense	probably benign	0.19
IGL02501:Slc4a4	APN	5	89129649	missense	probably benign	0.13
IGL03104:Slc4a4	APN	5	89149372	missense	probably damaging	1.00
IGL03157:Slc4a4	APN	5	89156513	missense	probably damaging	0.99
IGL03205:Slc4a4	APN	5	89149330	missense	probably benign	0.00
IGL03356:Slc4a4	APN	5	89122483	missense	probably benign	0.00
IGL03372:Slc4a4	APN	5	89156426	missense	probably damaging	1.00
IGL03382:Slc4a4	APN	5	89228836	missense	probably damaging	1.00
camera	UTSW	5	89132507	missense	probably damaging	1.00
pixels	UTSW	5	89122403	missense	probably damaging	0.99
Shutter	UTSW	5	89225948	missense	probably damaging	1.00
Tetrapod	UTSW	5	89228972	missense	probably damaging	1.00
Therapod	UTSW	5	89135722	missense	probably damaging	1.00
tripod	UTSW	5	89149333	missense	possibly damaging	0.52
BB008:Slc4a4	UTSW	5	89170781	missense	probably benign	0.00
BB018:Slc4a4	UTSW	5	89170781	missense	probably benign	0.00
PIT4515001:Slc4a4	UTSW	5	89133253	missense	probably damaging	1.00
PIT4544001:Slc4a4	UTSW	5	89038543	missense	probably damaging	1.00
R0007:Slc4a4	UTSW	5	89038578	missense	probably damaging	1.00
R0052:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0052:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0054:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0055:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0230:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0234:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0234:Slc4a4	UTSW	5	89156336	missense	possibly damaging	0.71
R0632:Slc4a4	UTSW	5	89129641	missense	probably damaging	1.00
R1199:Slc4a4	UTSW	5	89215794	critical splice donor site	probably null
R1597:Slc4a4	UTSW	5	89135728	missense	probably benign	0.01
R1783:Slc4a4	UTSW	5	89132414	missense	probably damaging	1.00
R1813:Slc4a4	UTSW	5	89046308	missense	probably damaging	0.98
R1896:Slc4a4	UTSW	5	89046308	missense	probably damaging	0.98
R2000:Slc4a4	UTSW	5	89028347	missense	probably damaging	1.00
R2139:Slc4a4	UTSW	5	89046264	missense	probably damaging	1.00
R2163:Slc4a4	UTSW	5	89214576	missense	probably damaging	1.00
R2513:Slc4a4	UTSW	5	89156398	missense	probably benign	0.00
R2873:Slc4a4	UTSW	5	89135764	missense	probably damaging	1.00
R2995:Slc4a4	UTSW	5	88934814	missense	probably damaging	1.00
R3054:Slc4a4	UTSW	5	89225948	missense	probably damaging	1.00
R3055:Slc4a4	UTSW	5	89225948	missense	probably damaging	1.00
R3056:Slc4a4	UTSW	5	89225948	missense	probably damaging	1.00
R3617:Slc4a4	UTSW	5	89234804	missense	probably benign	0.00
R3856:Slc4a4	UTSW	5	89232839	missense	probably benign	0.00
R3863:Slc4a4	UTSW	5	89135648	missense	possibly damaging	0.95
R3896:Slc4a4	UTSW	5	89197766	splice site	probably benign
R4007:Slc4a4	UTSW	5	89214593	missense	probably damaging	1.00
R4616:Slc4a4	UTSW	5	89038561	missense	probably damaging	1.00
R4740:Slc4a4	UTSW	5	89225894	missense	probably damaging	1.00
R5009:Slc4a4	UTSW	5	89149298	critical splice acceptor site	probably null
R5119:Slc4a4	UTSW	5	88954862	missense	probably null	0.97
R5228:Slc4a4	UTSW	5	89156525	missense	possibly damaging	0.50
R5394:Slc4a4	UTSW	5	89197764	critical splice donor site	probably null
R5396:Slc4a4	UTSW	5	89046217	missense	probably benign	0.00
R5662:Slc4a4	UTSW	5	89028244	missense	probably damaging	0.96
R5664:Slc4a4	UTSW	5	89028244	missense	probably damaging	0.96
R6021:Slc4a4	UTSW	5	89040402	intron	probably benign
R6088:Slc4a4	UTSW	5	89197704	missense	probably benign	0.12
R6337:Slc4a4	UTSW	5	89046372	missense	probably benign	0.21
R6416:Slc4a4	UTSW	5	89179729	missense	probably benign	0.26
R6452:Slc4a4	UTSW	5	89228980	missense	probably benign	0.05
R6524:Slc4a4	UTSW	5	89232764	missense	probably benign	0.01
R6566:Slc4a4	UTSW	5	89149333	missense	possibly damaging	0.52
R6727:Slc4a4	UTSW	5	89170765	missense	probably benign	0.00
R6844:Slc4a4	UTSW	5	89228972	missense	probably damaging	1.00
R6970:Slc4a4	UTSW	5	89179831	missense	probably damaging	0.98
R7021:Slc4a4	UTSW	5	89040346	splice site	probably null
R7180:Slc4a4	UTSW	5	89046236	missense	probably damaging	0.97
R7197:Slc4a4	UTSW	5	88934574	intron	probably benign
R7246:Slc4a4	UTSW	5	89122403	missense	probably damaging	0.99
R7309:Slc4a4	UTSW	5	89170751	missense	probably benign
R7412:Slc4a4	UTSW	5	89214647	splice site	probably null
R7492:Slc4a4	UTSW	5	89129650	missense	possibly damaging	0.92
R7561:Slc4a4	UTSW	5	89199697	missense	probably damaging	1.00
R7577:Slc4a4	UTSW	5	89225867	missense	probably damaging	0.97
R7609:Slc4a4	UTSW	5	89135686	missense	probably damaging	1.00
R7781:Slc4a4	UTSW	5	89228932	missense	possibly damaging	0.78
R7931:Slc4a4	UTSW	5	89170781	missense	probably benign	0.00
R7950:Slc4a4	UTSW	5	89058278	splice site	probably null
R8078:Slc4a4	UTSW	5	89179707	missense	probably benign	0.00
R8313:Slc4a4	UTSW	5	89046263	missense	possibly damaging	0.84
R8332:Slc4a4	UTSW	5	89179821	missense	probably benign	0.11
R8534:Slc4a4	UTSW	5	89135722	missense	probably damaging	1.00
R8735:Slc4a4	UTSW	5	89132442	missense	probably damaging	1.00
R8786:Slc4a4	UTSW	5	89084690	missense	probably benign	0.07
R8968:Slc4a4	UTSW	5	89084653	missense	probably benign
R9014:Slc4a4	UTSW	5	89132386	missense	probably damaging	1.00
R9031:Slc4a4	UTSW	5	89057709	intron	probably benign
R9195:Slc4a4	UTSW	5	89133196	missense	possibly damaging	0.82
R9236:Slc4a4	UTSW	5	89046299	nonsense	probably null
R9261:Slc4a4	UTSW	5	89199709	missense	probably damaging	1.00
R9325:Slc4a4	UTSW	5	89228897	missense	probably damaging	1.00
R9401:Slc4a4	UTSW	5	89179666	missense	probably damaging	1.00
R9457:Slc4a4	UTSW	5	89214573	missense	probably damaging	1.00
R9462:Slc4a4	UTSW	5	89046272	missense	probably damaging	1.00
R9681:Slc4a4	UTSW	5	88954864	nonsense	probably null
R9709:Slc4a4	UTSW	5	89040346	splice site	probably null
Z1177:Slc4a4	UTSW	5	89132459	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAAGTTGGCTCGTTGGCTC -3'
(R):5'- TCCCCAAAGAACAGTGGTGAC -3'

Sequencing Primer
(F):5'- TCGTTGGCTCAGCACTG -3'
(R):5'- CAGTGCCAAGTGAATGTTATGC -3'

Posted On

2015-02-05