Incidental Mutation 'R3055:Atp6v0a2'
ID265120
Institutional Source Beutler Lab
Gene Symbol Atp6v0a2
Ensembl Gene ENSMUSG00000038023
Gene NameATPase, H+ transporting, lysosomal V0 subunit A2
SynonymsV-ATPase a2, Atp6n2, 8430408C20Rik, Tj6, ATP6a2, TJ6s
MMRRC Submission 040564-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R3055 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location124628576-124724455 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 124627144 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037865] [ENSMUST00000198382]
Predicted Effect probably benign
Transcript: ENSMUST00000037865
SMART Domains Protein: ENSMUSP00000039737
Gene: ENSMUSG00000038023

DomainStartEndE-ValueType
Pfam:V_ATPase_I 27 842 3.3e-299 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100706
SMART Domains Protein: ENSMUSP00000098272
Gene: ENSMUSG00000029386

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:DUF1619 171 442 6.8e-75 PFAM
low complexity region 669 681 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130912
SMART Domains Protein: ENSMUSP00000114298
Gene: ENSMUSG00000029386

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:DUF1619 171 442 1.5e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185820
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197931
Predicted Effect probably benign
Transcript: ENSMUST00000198382
SMART Domains Protein: ENSMUSP00000143284
Gene: ENSMUSG00000038023

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:V_ATPase_I 26 178 1.5e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200292
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: This gene encodes a subunit of vacuolar ATPase, a multimeric enzyme that localizes to intracellular vesicles and to the plasma membrane of specialized cells. The encoded protein is a component of the V(0) domain, which functions in proton translocation across membranes. Function of this gene is important in fetal-specific immune suppression during pregnancy. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610042L04Rik A G 14: 4,348,878 E13G probably damaging Het
5730596B20Rik A T 6: 52,179,128 probably benign Het
A230050P20Rik AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA 9: 20,873,717 probably benign Het
Abca16 A G 7: 120,435,851 M287V probably benign Het
Abca7 G A 10: 79,999,747 R283H probably damaging Het
Acad11 A G 9: 104,076,336 I126V probably damaging Het
Ahrr A G 13: 74,224,887 V148A probably damaging Het
Aldh1l2 T C 10: 83,502,472 K528E probably benign Het
Atxn10 A G 15: 85,387,005 D248G probably benign Het
Bard1 A G 1: 71,088,231 V73A possibly damaging Het
Catsper3 T C 13: 55,808,896 S376P unknown Het
Ccdc150 A G 1: 54,288,842 N361S possibly damaging Het
Cxcr6 A T 9: 123,810,464 I177F probably damaging Het
D330045A20Rik T A X: 139,511,557 V439E possibly damaging Het
Ddx25 A G 9: 35,551,351 V246A probably damaging Het
Drd4 T C 7: 141,294,479 V319A probably damaging Het
Dscam G A 16: 96,801,355 T629I probably damaging Het
Evi5l C T 8: 4,191,603 R311* probably null Het
Fxr1 A G 3: 34,049,184 E221G probably damaging Het
Gldn A T 9: 54,338,523 T453S probably damaging Het
Gm436 A G 4: 144,674,698 I72T probably benign Het
Ighm T A 12: 113,418,976 probably benign Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Lgr5 T A 10: 115,466,123 probably benign Het
Mier3 T A 13: 111,691,303 D7E probably damaging Het
Mms19 A T 19: 41,950,088 probably benign Het
Mrpl20 G T 4: 155,803,872 V43F possibly damaging Het
Muc5b G T 7: 141,864,041 V3575F probably damaging Het
Naip5 T C 13: 100,221,878 Y950C probably benign Het
Olfr1094 T C 2: 86,829,127 F125S possibly damaging Het
Olfr463 A G 11: 87,893,372 V184A possibly damaging Het
Olfr875 G T 9: 37,773,193 C178F probably damaging Het
Pkd1l2 T A 8: 117,068,315 probably null Het
Prune2 A G 19: 17,125,043 E2522G probably damaging Het
Radil T C 5: 142,495,406 T549A possibly damaging Het
Rasa2 G A 9: 96,611,473 L53F possibly damaging Het
Rasgrf2 A G 13: 92,029,075 F306L probably damaging Het
Rbm19 C T 5: 120,133,010 R633C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc4a4 T A 5: 89,132,507 L353H probably damaging Het
Slc4a4 T C 5: 89,225,948 V971A probably damaging Het
Stil T A 4: 115,014,069 probably benign Het
Tjp3 T C 10: 81,280,507 K251R probably benign Het
Ugt2b35 A T 5: 87,001,598 Y236F probably benign Het
Utp14b T A 1: 78,664,725 D113E possibly damaging Het
Vmn1r121 G A 7: 21,098,465 Q17* probably null Het
Vmn2r28 A T 7: 5,481,392 L603Q probably damaging Het
Vps13b A G 15: 35,646,361 E1537G probably damaging Het
Xrcc4 T C 13: 90,062,077 T83A probably benign Het
Yae1d1 T C 13: 17,993,242 E22G probably damaging Het
Other mutations in Atp6v0a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Atp6v0a2 APN 5 124721777 missense probably benign 0.19
IGL01310:Atp6v0a2 APN 5 124646028 missense probably damaging 1.00
IGL01944:Atp6v0a2 APN 5 124636105 missense probably benign 0.04
IGL02044:Atp6v0a2 APN 5 124646014 missense probably benign 0.00
IGL02400:Atp6v0a2 APN 5 124721785 missense probably benign
IGL02650:Atp6v0a2 APN 5 124712362 splice site probably benign
IGL02687:Atp6v0a2 APN 5 124714142 missense possibly damaging 0.67
IGL02965:Atp6v0a2 APN 5 124629202 missense possibly damaging 0.85
IGL03049:Atp6v0a2 APN 5 124712781 missense probably damaging 1.00
IGL03088:Atp6v0a2 APN 5 124714107 splice site probably benign
IGL03198:Atp6v0a2 APN 5 124712361 critical splice donor site probably null
alkaline UTSW 5 124719866 missense probably damaging 1.00
basic UTSW 5 124712328 nonsense probably null
R0128:Atp6v0a2 UTSW 5 124713184 missense probably damaging 1.00
R0594:Atp6v0a2 UTSW 5 124717982 missense probably benign 0.01
R1540:Atp6v0a2 UTSW 5 124646698 missense probably damaging 1.00
R2136:Atp6v0a2 UTSW 5 124718488 missense possibly damaging 0.78
R2921:Atp6v0a2 UTSW 5 124717917 missense possibly damaging 0.80
R2922:Atp6v0a2 UTSW 5 124717917 missense possibly damaging 0.80
R2923:Atp6v0a2 UTSW 5 124717917 missense possibly damaging 0.80
R3889:Atp6v0a2 UTSW 5 124639265 missense probably damaging 1.00
R3893:Atp6v0a2 UTSW 5 124639265 missense probably damaging 1.00
R4013:Atp6v0a2 UTSW 5 124712796 missense probably damaging 1.00
R4490:Atp6v0a2 UTSW 5 124646734 missense probably damaging 1.00
R4791:Atp6v0a2 UTSW 5 124646727 missense probably benign 0.17
R5219:Atp6v0a2 UTSW 5 124713185 missense probably damaging 1.00
R5247:Atp6v0a2 UTSW 5 124713177 missense probably damaging 1.00
R5293:Atp6v0a2 UTSW 5 124646709 missense probably benign 0.00
R5620:Atp6v0a2 UTSW 5 124645969 nonsense probably null
R5830:Atp6v0a2 UTSW 5 124641547 missense probably damaging 1.00
R5875:Atp6v0a2 UTSW 5 124716327 missense probably benign
R5903:Atp6v0a2 UTSW 5 124712279 missense probably damaging 1.00
R6192:Atp6v0a2 UTSW 5 124629203 missense probably benign 0.01
R6425:Atp6v0a2 UTSW 5 124713130 missense probably damaging 1.00
R6752:Atp6v0a2 UTSW 5 124641514 missense probably damaging 1.00
R6919:Atp6v0a2 UTSW 5 124712161 intron probably null
R6994:Atp6v0a2 UTSW 5 124714145 missense probably damaging 1.00
R7053:Atp6v0a2 UTSW 5 124645983 missense probably damaging 1.00
R7268:Atp6v0a2 UTSW 5 124719866 missense probably damaging 1.00
R7342:Atp6v0a2 UTSW 5 124646736 missense probably damaging 1.00
R7349:Atp6v0a2 UTSW 5 124712328 nonsense probably null
R7714:Atp6v0a2 UTSW 5 124637595 missense probably damaging 1.00
R7715:Atp6v0a2 UTSW 5 124714198 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCATTCCTAGCCTTCTGGATGG -3'
(R):5'- TGGCTCACGTTCACTTAACAC -3'

Sequencing Primer
(F):5'- TCCTAGCCTTCTGGATGGAAAAG -3'
(R):5'- GGTGGAACATGCCTTTAATCCAGC -3'
Posted On2015-02-05