Mutagenetix > Incidental Mutation

Incidental Mutation 'R3055:Muc5b'

265126

Institutional Source

Beutler Lab

Gene Symbol

Muc5b

Ensembl Gene

ENSMUSG00000066108

Gene Name

mucin 5, subtype B, tracheobronchial

Synonyms

MUC5, MUC9, 2300002I04Rik

MMRRC Submission

040564-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.261) question?

Stock #

R3055 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

141839070-141873084 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 141864041 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 3575 (V3575F)

Ref Sequence

ENSEMBL: ENSMUSP00000128276 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000165147]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000165147
AA Change: V3575F

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000128276
Gene: ENSMUSG00000066108
AA Change: V3575F

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
VWD	73	228	1.12e-25	SMART
C8	267	330	7.26e-8	SMART
Pfam:TIL	333	389	1.1e-13	PFAM
VWC	391	459	1.35e-1	SMART
VWD	418	582	2.87e-37	SMART
C8	619	693	2.53e-30	SMART
Pfam:TIL	699	756	2.6e-10	PFAM
VWC	758	823	1.26e0	SMART
VWC	861	930	1.58e-7	SMART
VWD	888	1048	3e-40	SMART
C8	1084	1158	3.75e-33	SMART
low complexity region	1314	1328	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1345	1432	6.7e-27	PFAM
low complexity region	1447	1468	N/A	INTRINSIC
low complexity region	1498	1517	N/A	INTRINSIC
low complexity region	1543	1558	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1574	1663	2.1e-26	PFAM
low complexity region	1678	1693	N/A	INTRINSIC
low complexity region	1728	1745	N/A	INTRINSIC
low complexity region	1778	1831	N/A	INTRINSIC
Pfam:Mucin2_WxxW	1870	1959	2.7e-26	PFAM
low complexity region	1967	1990	N/A	INTRINSIC
low complexity region	2024	2041	N/A	INTRINSIC
low complexity region	2074	2127	N/A	INTRINSIC
Pfam:Mucin2_WxxW	2184	2273	2.1e-26	PFAM
low complexity region	2281	2304	N/A	INTRINSIC
low complexity region	2338	2355	N/A	INTRINSIC
low complexity region	2388	2441	N/A	INTRINSIC
Pfam:Mucin2_WxxW	2498	2587	2.1e-26	PFAM
low complexity region	2596	2618	N/A	INTRINSIC
low complexity region	2623	2654	N/A	INTRINSIC
low complexity region	2660	2681	N/A	INTRINSIC
Pfam:Mucin2_WxxW	2687	2776	3.8e-25	PFAM
low complexity region	2781	2796	N/A	INTRINSIC
low complexity region	2958	3009	N/A	INTRINSIC
Pfam:Mucin2_WxxW	3066	3155	2.6e-26	PFAM
low complexity region	3220	3237	N/A	INTRINSIC
low complexity region	3270	3317	N/A	INTRINSIC
Pfam:Mucin2_WxxW	3380	3469	3.4e-26	PFAM
low complexity region	3509	3529	N/A	INTRINSIC
low complexity region	3546	3562	N/A	INTRINSIC
low complexity region	3568	3591	N/A	INTRINSIC
Pfam:Mucin2_WxxW	3624	3713	2.6e-27	PFAM
Pfam:Mucin2_WxxW	3778	3867	3.2e-24	PFAM
low complexity region	3883	3900	N/A	INTRINSIC
low complexity region	3910	3934	N/A	INTRINSIC
low complexity region	3959	3976	N/A	INTRINSIC
low complexity region	4033	4053	N/A	INTRINSIC
VWD	4111	4283	6.75e-34	SMART
C8	4336	4403	4.26e-14	SMART
VWC	4461	4530	7.06e-5	SMART
VWC	4570	4631	6.53e-9	SMART
CT	4708	4790	2.93e-26	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin family of proteins, which are highly glycosylated macromolecular components of mucus secretions. This family member is the major gel-forming mucin in mucus. It is a major contributor to the lubricating and viscoelastic properties of whole saliva, normal lung mucus and cervical mucus. This gene has been found to be up-regulated in some human diseases, including sinus mucosa of chronic rhinosinusitis (CRS), CRS with nasal polyposis, chronic obstructive pulmonary disease (COPD) and H. pylori-associated gastric disease, and it may be involved in the pathogenesis of these diseases. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a knock-out allele accumulate materials in the upper and lower airways leading to chronic infection and inflammation that does not resolve and results in premature death. Macrophage function is impaired. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610042L04Rik	A	G	14: 4,348,878	E13G	probably damaging	Het
5730596B20Rik	A	T	6: 52,179,128		probably benign	Het
A230050P20Rik	AGAGGAGGAGGAGGAGGAGGAGGAGGA	AGAGGAGGAGGAGGAGGAGGAGGA	9: 20,873,717		probably benign	Het
Abca16	A	G	7: 120,435,851	M287V	probably benign	Het
Abca7	G	A	10: 79,999,747	R283H	probably damaging	Het
Acad11	A	G	9: 104,076,336	I126V	probably damaging	Het
Ahrr	A	G	13: 74,224,887	V148A	probably damaging	Het
Aldh1l2	T	C	10: 83,502,472	K528E	probably benign	Het
Atp6v0a2	T	A	5: 124,627,144		probably benign	Het
Atxn10	A	G	15: 85,387,005	D248G	probably benign	Het
Bard1	A	G	1: 71,088,231	V73A	possibly damaging	Het
Catsper3	T	C	13: 55,808,896	S376P	unknown	Het
Ccdc150	A	G	1: 54,288,842	N361S	possibly damaging	Het
Cxcr6	A	T	9: 123,810,464	I177F	probably damaging	Het
D330045A20Rik	T	A	X: 139,511,557	V439E	possibly damaging	Het
Ddx25	A	G	9: 35,551,351	V246A	probably damaging	Het
Drd4	T	C	7: 141,294,479	V319A	probably damaging	Het
Dscam	G	A	16: 96,801,355	T629I	probably damaging	Het
Evi5l	C	T	8: 4,191,603	R311*	probably null	Het
Fxr1	A	G	3: 34,049,184	E221G	probably damaging	Het
Gldn	A	T	9: 54,338,523	T453S	probably damaging	Het
Gm436	A	G	4: 144,674,698	I72T	probably benign	Het
Ighm	T	A	12: 113,418,976		probably benign	Het
Ints12	G	A	3: 133,109,365	M444I	possibly damaging	Het
Lgr5	T	A	10: 115,466,123		probably benign	Het
Mier3	T	A	13: 111,691,303	D7E	probably damaging	Het
Mms19	A	T	19: 41,950,088		probably benign	Het
Mrpl20	G	T	4: 155,803,872	V43F	possibly damaging	Het
Naip5	T	C	13: 100,221,878	Y950C	probably benign	Het
Olfr1094	T	C	2: 86,829,127	F125S	possibly damaging	Het
Olfr463	A	G	11: 87,893,372	V184A	possibly damaging	Het
Olfr875	G	T	9: 37,773,193	C178F	probably damaging	Het
Pkd1l2	T	A	8: 117,068,315		probably null	Het
Prune2	A	G	19: 17,125,043	E2522G	probably damaging	Het
Radil	T	C	5: 142,495,406	T549A	possibly damaging	Het
Rasa2	G	A	9: 96,611,473	L53F	possibly damaging	Het
Rasgrf2	A	G	13: 92,029,075	F306L	probably damaging	Het
Rbm19	C	T	5: 120,133,010	R633C	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Slc4a4	T	A	5: 89,132,507	L353H	probably damaging	Het
Slc4a4	T	C	5: 89,225,948	V971A	probably damaging	Het
Stil	T	A	4: 115,014,069		probably benign	Het
Tjp3	T	C	10: 81,280,507	K251R	probably benign	Het
Ugt2b35	A	T	5: 87,001,598	Y236F	probably benign	Het
Utp14b	T	A	1: 78,664,725	D113E	possibly damaging	Het
Vmn1r121	G	A	7: 21,098,465	Q17*	probably null	Het
Vmn2r28	A	T	7: 5,481,392	L603Q	probably damaging	Het
Vps13b	A	G	15: 35,646,361	E1537G	probably damaging	Het
Xrcc4	T	C	13: 90,062,077	T83A	probably benign	Het
Yae1d1	T	C	13: 17,993,242	E22G	probably damaging	Het

Other mutations in Muc5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00586:Muc5b	APN	7	141841392	missense	unknown
IGL00677:Muc5b	APN	7	141857894	nonsense	probably null
IGL00740:Muc5b	APN	7	141855598	missense	unknown
IGL01084:Muc5b	APN	7	141843449	splice site	probably benign
IGL01384:Muc5b	APN	7	141846818	missense	unknown
IGL01447:Muc5b	APN	7	141863094	missense	probably benign	0.01
IGL01510:Muc5b	APN	7	141859061	missense	unknown
IGL01532:Muc5b	APN	7	141870006	missense	possibly damaging	0.96
IGL01556:Muc5b	APN	7	141863240	missense	probably benign	0.01
IGL01608:Muc5b	APN	7	141846437	missense	unknown
IGL01884:Muc5b	APN	7	141868083	splice site	probably benign
IGL01943:Muc5b	APN	7	141861497	missense	possibly damaging	0.71
IGL02039:Muc5b	APN	7	141871164	missense	possibly damaging	0.96
IGL02089:Muc5b	APN	7	141863250	missense	probably benign	0.04
IGL02110:Muc5b	APN	7	141847716	nonsense	probably null
IGL02123:Muc5b	APN	7	141863757	missense	possibly damaging	0.68
IGL02124:Muc5b	APN	7	141855632	missense	unknown
IGL02141:Muc5b	APN	7	141853367	missense	unknown
IGL02409:Muc5b	APN	7	141861338	missense	possibly damaging	0.53
IGL02448:Muc5b	APN	7	141868489	missense	possibly damaging	0.53
IGL02503:Muc5b	APN	7	141867667	missense	probably benign	0.33
IGL02504:Muc5b	APN	7	141846440	missense	unknown
IGL02528:Muc5b	APN	7	141864017	missense	probably benign	0.01
IGL02534:Muc5b	APN	7	141844719	missense	unknown
IGL02565:Muc5b	APN	7	141857867	missense	unknown
IGL02630:Muc5b	APN	7	141863231	missense	probably benign	0.03
IGL02881:Muc5b	APN	7	141857712	missense	unknown
IGL02963:Muc5b	APN	7	141864264	missense	probably damaging	1.00
IGL03003:Muc5b	APN	7	141863614	missense	probably benign	0.03
IGL03013:Muc5b	APN	7	141863928	missense	possibly damaging	0.68
IGL03102:Muc5b	APN	7	141863069	missense	probably benign	0.35
IGL03114:Muc5b	APN	7	141858819	nonsense	probably null
IGL03150:Muc5b	APN	7	141865509	missense	possibly damaging	0.53
IGL03185:Muc5b	APN	7	141862822	missense	possibly damaging	0.83
IGL03299:Muc5b	APN	7	141841380	missense	unknown
IGL03336:Muc5b	APN	7	141864363	missense	probably damaging	1.00
IGL03370:Muc5b	APN	7	141864777	missense	probably benign	0.34
IGL03375:Muc5b	APN	7	141861962	missense	possibly damaging	0.53
IGL03393:Muc5b	APN	7	141864138	missense	probably benign	0.21
profligate	UTSW	7	141857822	nonsense	probably null
wasteful	UTSW	7	141858161	missense	unknown
R0045:Muc5b	UTSW	7	141856818	missense	unknown
R0256:Muc5b	UTSW	7	141841395	missense	unknown
R0256:Muc5b	UTSW	7	141843258	missense	unknown
R0321:Muc5b	UTSW	7	141862235	missense	probably benign	0.19
R0391:Muc5b	UTSW	7	141865082	missense	possibly damaging	0.73
R0458:Muc5b	UTSW	7	141864972	missense	probably benign	0.20
R0491:Muc5b	UTSW	7	141862015	missense	probably benign	0.01
R0543:Muc5b	UTSW	7	141851785	missense	unknown
R0583:Muc5b	UTSW	7	141856698	nonsense	probably null
R0611:Muc5b	UTSW	7	141862436	missense	probably benign	0.18
R0625:Muc5b	UTSW	7	141846427	missense	unknown
R0655:Muc5b	UTSW	7	141863942	missense	probably benign	0.01
R0845:Muc5b	UTSW	7	141850446	splice site	probably null
R0863:Muc5b	UTSW	7	141867717	missense	probably benign	0.18
R0965:Muc5b	UTSW	7	141863802	missense	possibly damaging	0.92
R0988:Muc5b	UTSW	7	141871795	missense	probably benign	0.03
R1140:Muc5b	UTSW	7	141858996	missense	unknown
R1209:Muc5b	UTSW	7	141857910	missense	unknown
R1333:Muc5b	UTSW	7	141868407	missense	possibly damaging	0.53
R1337:Muc5b	UTSW	7	141858624	missense	unknown
R1385:Muc5b	UTSW	7	141862137	missense	probably benign	0.00
R1463:Muc5b	UTSW	7	141859080	missense	unknown
R1471:Muc5b	UTSW	7	141843234	missense	unknown
R1617:Muc5b	UTSW	7	141863524	nonsense	probably null
R1736:Muc5b	UTSW	7	141859107	missense	unknown
R1752:Muc5b	UTSW	7	141867751	missense	possibly damaging	0.96
R1804:Muc5b	UTSW	7	141863780	missense	possibly damaging	0.68
R1806:Muc5b	UTSW	7	141865493	missense	possibly damaging	0.68
R1895:Muc5b	UTSW	7	141857645	missense	unknown
R1902:Muc5b	UTSW	7	141864105	missense	possibly damaging	0.77
R1919:Muc5b	UTSW	7	141846031	missense	unknown
R1924:Muc5b	UTSW	7	141868223	missense	possibly damaging	0.53
R1942:Muc5b	UTSW	7	141857684	missense	unknown
R1959:Muc5b	UTSW	7	141862637	missense	possibly damaging	0.86
R1960:Muc5b	UTSW	7	141862637	missense	possibly damaging	0.86
R1976:Muc5b	UTSW	7	141863154	missense	probably benign	0.01
R2080:Muc5b	UTSW	7	141869754	missense	probably benign	0.33
R2178:Muc5b	UTSW	7	141864116	missense	possibly damaging	0.58
R2184:Muc5b	UTSW	7	141858864	nonsense	probably null
R2229:Muc5b	UTSW	7	141861644	missense	possibly damaging	0.71
R2237:Muc5b	UTSW	7	141862089	missense	probably benign	0.00
R2509:Muc5b	UTSW	7	141859061	missense	unknown
R2510:Muc5b	UTSW	7	141859061	missense	unknown
R2512:Muc5b	UTSW	7	141859076	missense	unknown
R2888:Muc5b	UTSW	7	141861554	missense	probably damaging	0.98
R3054:Muc5b	UTSW	7	141864041	missense	probably damaging	0.97
R3108:Muc5b	UTSW	7	141858759	missense	unknown
R3109:Muc5b	UTSW	7	141858759	missense	unknown
R3113:Muc5b	UTSW	7	141846134	missense	unknown
R3551:Muc5b	UTSW	7	141861335	missense	possibly damaging	0.53
R3552:Muc5b	UTSW	7	141861335	missense	possibly damaging	0.53
R3552:Muc5b	UTSW	7	141867705	missense	probably benign	0.18
R3622:Muc5b	UTSW	7	141851858	splice site	probably benign
R3700:Muc5b	UTSW	7	141847249	missense	unknown
R3734:Muc5b	UTSW	7	141859037	nonsense	probably null
R3785:Muc5b	UTSW	7	141865116	missense	possibly damaging	0.86
R3786:Muc5b	UTSW	7	141865116	missense	possibly damaging	0.86
R3788:Muc5b	UTSW	7	141863834	missense	possibly damaging	0.68
R3810:Muc5b	UTSW	7	141864126	missense	possibly damaging	0.58
R3834:Muc5b	UTSW	7	141859181	missense	unknown
R3835:Muc5b	UTSW	7	141859181	missense	unknown
R3850:Muc5b	UTSW	7	141862638	missense	possibly damaging	0.95
R3877:Muc5b	UTSW	7	141857552	missense	unknown
R3909:Muc5b	UTSW	7	141849498	missense	unknown
R3964:Muc5b	UTSW	7	141866968	missense	possibly damaging	0.73
R4014:Muc5b	UTSW	7	141863630	missense	probably benign	0.40
R4015:Muc5b	UTSW	7	141863630	missense	probably benign	0.40
R4017:Muc5b	UTSW	7	141863630	missense	probably benign	0.40
R4042:Muc5b	UTSW	7	141864887	missense	possibly damaging	0.92
R4200:Muc5b	UTSW	7	141858925	nonsense	probably null
R4230:Muc5b	UTSW	7	141863522	missense	probably benign	0.03
R4400:Muc5b	UTSW	7	141861387	missense	possibly damaging	0.92
R4455:Muc5b	UTSW	7	141858818	missense	unknown
R4484:Muc5b	UTSW	7	141868450	missense	possibly damaging	0.73
R4630:Muc5b	UTSW	7	141857984	missense	unknown
R4646:Muc5b	UTSW	7	141862640	missense	probably benign	0.34
R4658:Muc5b	UTSW	7	141841398	missense	unknown
R4667:Muc5b	UTSW	7	141842379	missense	unknown
R4690:Muc5b	UTSW	7	141842294	missense	unknown
R4697:Muc5b	UTSW	7	141857361	missense	unknown
R4711:Muc5b	UTSW	7	141846033	missense	unknown
R4713:Muc5b	UTSW	7	141849079	nonsense	probably null
R4749:Muc5b	UTSW	7	141861448	nonsense	probably null
R4753:Muc5b	UTSW	7	141856853	missense	unknown
R4782:Muc5b	UTSW	7	141847716	nonsense	probably null
R4795:Muc5b	UTSW	7	141849567	missense	unknown
R4796:Muc5b	UTSW	7	141864246	missense	possibly damaging	0.52
R4799:Muc5b	UTSW	7	141847716	nonsense	probably null
R4824:Muc5b	UTSW	7	141864185	missense	probably damaging	1.00
R4825:Muc5b	UTSW	7	141868465	missense	possibly damaging	0.96
R5068:Muc5b	UTSW	7	141858608	missense	unknown
R5073:Muc5b	UTSW	7	141859262	missense	unknown
R5074:Muc5b	UTSW	7	141859262	missense	unknown
R5107:Muc5b	UTSW	7	141855531	missense	unknown
R5152:Muc5b	UTSW	7	141865531	missense	possibly damaging	0.53
R5183:Muc5b	UTSW	7	141850810	missense	unknown
R5191:Muc5b	UTSW	7	141858539	missense	unknown
R5254:Muc5b	UTSW	7	141864540	missense	probably benign	0.09
R5320:Muc5b	UTSW	7	141859001	missense	unknown
R5352:Muc5b	UTSW	7	141864558	missense	possibly damaging	0.66
R5378:Muc5b	UTSW	7	141862203	missense	unknown
R5417:Muc5b	UTSW	7	141858044	missense	unknown
R5548:Muc5b	UTSW	7	141863942	missense	probably benign	0.01
R5551:Muc5b	UTSW	7	141868503	missense	possibly damaging	0.73
R5562:Muc5b	UTSW	7	141847238	missense	unknown
R5580:Muc5b	UTSW	7	141861347	missense	possibly damaging	0.53
R5629:Muc5b	UTSW	7	141861299	missense	possibly damaging	0.73
R5758:Muc5b	UTSW	7	141858983	missense	unknown
R5783:Muc5b	UTSW	7	141858428	nonsense	probably null
R5795:Muc5b	UTSW	7	141871741	missense	possibly damaging	0.96
R5796:Muc5b	UTSW	7	141857396	missense	unknown
R5797:Muc5b	UTSW	7	141851582	missense	unknown
R5806:Muc5b	UTSW	7	141862835	missense	possibly damaging	0.68
R5888:Muc5b	UTSW	7	141858421	missense	unknown
R5910:Muc5b	UTSW	7	141861311	missense	possibly damaging	0.53
R5956:Muc5b	UTSW	7	141864173	missense	probably damaging	0.99
R5970:Muc5b	UTSW	7	141856712	missense	unknown
R5990:Muc5b	UTSW	7	141858161	missense	unknown
R5999:Muc5b	UTSW	7	141857379	missense	unknown
R6001:Muc5b	UTSW	7	141872381	missense	possibly damaging	0.72
R6053:Muc5b	UTSW	7	141864708	missense	probably benign	0.07
R6073:Muc5b	UTSW	7	141849060	missense	unknown
R6073:Muc5b	UTSW	7	141858288	missense	unknown
R6112:Muc5b	UTSW	7	141863305	missense	probably benign	0.01
R6153:Muc5b	UTSW	7	141861444	missense	possibly damaging	0.71
R6164:Muc5b	UTSW	7	141863345	missense	possibly damaging	0.73
R6172:Muc5b	UTSW	7	141858776	missense	unknown
R6178:Muc5b	UTSW	7	141856342	missense	probably null
R6196:Muc5b	UTSW	7	141851596	missense	unknown
R6213:Muc5b	UTSW	7	141862166	missense	probably benign	0.00
R6213:Muc5b	UTSW	7	141867619	missense	possibly damaging	0.92
R6344:Muc5b	UTSW	7	141862971	missense	possibly damaging	0.62
R6400:Muc5b	UTSW	7	141858665	missense	unknown
R6414:Muc5b	UTSW	7	141859097	missense	unknown
R6521:Muc5b	UTSW	7	141859171	nonsense	probably null
R6658:Muc5b	UTSW	7	141868507	critical splice donor site	probably null
R6717:Muc5b	UTSW	7	141857822	nonsense	probably null
R6737:Muc5b	UTSW	7	141857499	missense	unknown
R6763:Muc5b	UTSW	7	141862284	missense	probably benign	0.01
R6817:Muc5b	UTSW	7	141862913	missense	probably benign	0.06
R6819:Muc5b	UTSW	7	141858863	missense	unknown
R6916:Muc5b	UTSW	7	141864717	missense	possibly damaging	0.71
R7030:Muc5b	UTSW	7	141842455	missense	unknown
R7116:Muc5b	UTSW	7	141863750	missense	probably benign	0.10
R7134:Muc5b	UTSW	7	141857654	missense	unknown
R7146:Muc5b	UTSW	7	141863967	missense	possibly damaging	0.96
R7168:Muc5b	UTSW	7	141864017	missense	probably benign	0.01
R7182:Muc5b	UTSW	7	141842645	missense	unknown
R7189:Muc5b	UTSW	7	141861061	nonsense	probably null
R7207:Muc5b	UTSW	7	141862865	missense	probably benign	0.01
R7232:Muc5b	UTSW	7	141866129	missense	possibly damaging	0.53
R7260:Muc5b	UTSW	7	141842648	missense	unknown
R7269:Muc5b	UTSW	7	141857535	missense	unknown
R7273:Muc5b	UTSW	7	141851570	missense	unknown
R7278:Muc5b	UTSW	7	141857502	missense	unknown
R7307:Muc5b	UTSW	7	141842294	missense	unknown
R7323:Muc5b	UTSW	7	141858707	missense	unknown
R7374:Muc5b	UTSW	7	141863126	missense	probably benign	0.10
R7376:Muc5b	UTSW	7	141872550	missense	possibly damaging	0.53
R7382:Muc5b	UTSW	7	141858948	missense	unknown
R7481:Muc5b	UTSW	7	141861171	missense	unknown
R7497:Muc5b	UTSW	7	141861513	missense	possibly damaging	0.92
R7554:Muc5b	UTSW	7	141858776	missense	unknown
R7571:Muc5b	UTSW	7	141847249	missense	unknown
R7598:Muc5b	UTSW	7	141859262	missense	unknown
R7609:Muc5b	UTSW	7	141861729	missense	possibly damaging	0.86
R7615:Muc5b	UTSW	7	141864892	nonsense	probably null
R7618:Muc5b	UTSW	7	141867597	missense	probably benign	0.01
R7651:Muc5b	UTSW	7	141864023	missense	possibly damaging	0.75
R7692:Muc5b	UTSW	7	141853229	missense	unknown
R7731:Muc5b	UTSW	7	141857305	critical splice acceptor site	probably null
R7746:Muc5b	UTSW	7	141862239	missense	probably benign	0.10
R7748:Muc5b	UTSW	7	141847805	missense	unknown
R7774:Muc5b	UTSW	7	141842379	missense	unknown
R7783:Muc5b	UTSW	7	141857341	missense	unknown
R7834:Muc5b	UTSW	7	141859070	missense	unknown
R7872:Muc5b	UTSW	7	141846113	missense	unknown
R7935:Muc5b	UTSW	7	141846832	missense	unknown
R8026:Muc5b	UTSW	7	141863636	missense	probably benign	0.03
R8036:Muc5b	UTSW	7	141867741	missense	possibly damaging	0.73
R8081:Muc5b	UTSW	7	141864006	missense	possibly damaging	0.88
R8096:Muc5b	UTSW	7	141849555	missense	unknown
R8101:Muc5b	UTSW	7	141865175	missense	possibly damaging	0.53
R8112:Muc5b	UTSW	7	141862028	missense	possibly damaging	0.53
R8131:Muc5b	UTSW	7	141842409	missense	unknown
R8170:Muc5b	UTSW	7	141861000	missense	unknown
R8171:Muc5b	UTSW	7	141861000	missense	unknown
R8191:Muc5b	UTSW	7	141867684	missense	probably benign	0.18
R8237:Muc5b	UTSW	7	141857960	missense	unknown
R8342:Muc5b	UTSW	7	141860865	missense	unknown
R8343:Muc5b	UTSW	7	141864161	missense	probably benign	0.28
R8389:Muc5b	UTSW	7	141861779	missense	possibly damaging	0.53
R8396:Muc5b	UTSW	7	141851815	missense	unknown
R8733:Muc5b	UTSW	7	141863795	missense	possibly damaging	0.68
R8774:Muc5b	UTSW	7	141865094	missense	probably benign	0.18
R8774-TAIL:Muc5b	UTSW	7	141865094	missense	probably benign	0.18
R8833:Muc5b	UTSW	7	141858368	missense	unknown
R8884:Muc5b	UTSW	7	141849419	missense	unknown
R8907:Muc5b	UTSW	7	141864138	missense	probably benign	0.21
R8944:Muc5b	UTSW	7	141867378	missense
R9025:Muc5b	UTSW	7	141872472	missense	probably damaging	0.98
R9044:Muc5b	UTSW	7	141858058	missense	unknown
R9117:Muc5b	UTSW	7	141869333	missense	possibly damaging	0.73
R9145:Muc5b	UTSW	7	141857613	missense	unknown
R9154:Muc5b	UTSW	7	141864237	missense	probably damaging	0.98
R9177:Muc5b	UTSW	7	141845338	missense	unknown
R9190:Muc5b	UTSW	7	141858202	missense	unknown
R9204:Muc5b	UTSW	7	141856392	missense	unknown
R9260:Muc5b	UTSW	7	141851518	missense	unknown
R9331:Muc5b	UTSW	7	141857738	missense	unknown
R9366:Muc5b	UTSW	7	141863304	missense	probably benign	0.01
R9402:Muc5b	UTSW	7	141845414	missense	unknown
R9462:Muc5b	UTSW	7	141861479	missense
R9463:Muc5b	UTSW	7	141851766	missense	unknown
R9490:Muc5b	UTSW	7	141871760	missense	probably benign	0.33
R9523:Muc5b	UTSW	7	141842379	missense	unknown
R9548:Muc5b	UTSW	7	141867911	missense	possibly damaging	0.52
R9591:Muc5b	UTSW	7	141858779	missense	unknown
R9602:Muc5b	UTSW	7	141863474	missense	probably benign	0.11
R9664:Muc5b	UTSW	7	141855542	missense	unknown
R9703:Muc5b	UTSW	7	141871798	missense	possibly damaging	0.53
R9713:Muc5b	UTSW	7	141862941	missense	probably benign	0.01
R9789:Muc5b	UTSW	7	141861593	missense	possibly damaging	0.95
R9800:Muc5b	UTSW	7	141861743	missense	possibly damaging	0.53
Z1088:Muc5b	UTSW	7	141862214	missense	probably benign	0.01
Z1176:Muc5b	UTSW	7	141842705	missense	unknown
Z1177:Muc5b	UTSW	7	141863173	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- CAACACTAGTCTGACCGTGACC -3'
(R):5'- TTTTACCGATCCCGAGGTCG -3'

Sequencing Primer
(F):5'- TAGTCTGACCGTGACCAGTCC -3'
(R):5'- GAGGTCGGTGAATCCACATC -3'

Posted On

2015-02-05