Mutagenetix > Incidental Mutations

Incidental Mutation 'R3055:Olfr875'

265131

Institutional Source

Beutler Lab

Gene Symbol

Olfr875

Ensembl Gene

ENSMUSG00000058628

Gene Name

olfactory receptor 875

Synonyms

GA_x6K02T2PVTD-31458511-31459443, MOR161-4

MMRRC Submission

040564-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.101) question?

Stock #

R3055 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

37771857-37774459 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 37773193 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Phenylalanine at position 178 (C178F)

Ref Sequence

ENSEMBL: ENSMUSP00000150684 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080634] [ENSMUST00000215128]

Predicted Effect

probably damaging
Transcript: ENSMUST00000080634
AA Change: C178F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000079467
Gene: ENSMUSG00000058628
AA Change: C178F

Domain	Start	End	E-Value	Type
Pfam:7tm_4	30	307	1.1e-48	PFAM
Pfam:7tm_1	40	289	1.8e-23	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000215128
AA Change: C178F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.5014

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610042L04Rik	A	G	14: 4,348,878	E13G	probably damaging	Het
5730596B20Rik	A	T	6: 52,179,128		probably benign	Het
A230050P20Rik	AGAGGAGGAGGAGGAGGAGGAGGAGGA	AGAGGAGGAGGAGGAGGAGGAGGA	9: 20,873,717		probably benign	Het
Abca16	A	G	7: 120,435,851	M287V	probably benign	Het
Abca7	G	A	10: 79,999,747	R283H	probably damaging	Het
Acad11	A	G	9: 104,076,336	I126V	probably damaging	Het
Ahrr	A	G	13: 74,224,887	V148A	probably damaging	Het
Aldh1l2	T	C	10: 83,502,472	K528E	probably benign	Het
Atp6v0a2	T	A	5: 124,627,144		probably benign	Het
Atxn10	A	G	15: 85,387,005	D248G	probably benign	Het
Bard1	A	G	1: 71,088,231	V73A	possibly damaging	Het
Catsper3	T	C	13: 55,808,896	S376P	unknown	Het
Ccdc150	A	G	1: 54,288,842	N361S	possibly damaging	Het
Cxcr6	A	T	9: 123,810,464	I177F	probably damaging	Het
D330045A20Rik	T	A	X: 139,511,557	V439E	possibly damaging	Het
Ddx25	A	G	9: 35,551,351	V246A	probably damaging	Het
Drd4	T	C	7: 141,294,479	V319A	probably damaging	Het
Dscam	G	A	16: 96,801,355	T629I	probably damaging	Het
Evi5l	C	T	8: 4,191,603	R311*	probably null	Het
Fxr1	A	G	3: 34,049,184	E221G	probably damaging	Het
Gldn	A	T	9: 54,338,523	T453S	probably damaging	Het
Gm436	A	G	4: 144,674,698	I72T	probably benign	Het
Ighm	T	A	12: 113,418,976		probably benign	Het
Ints12	G	A	3: 133,109,365	M444I	possibly damaging	Het
Lgr5	T	A	10: 115,466,123		probably benign	Het
Mier3	T	A	13: 111,691,303	D7E	probably damaging	Het
Mms19	A	T	19: 41,950,088		probably benign	Het
Mrpl20	G	T	4: 155,803,872	V43F	possibly damaging	Het
Muc5b	G	T	7: 141,864,041	V3575F	probably damaging	Het
Naip5	T	C	13: 100,221,878	Y950C	probably benign	Het
Olfr1094	T	C	2: 86,829,127	F125S	possibly damaging	Het
Olfr463	A	G	11: 87,893,372	V184A	possibly damaging	Het
Pkd1l2	T	A	8: 117,068,315		probably null	Het
Prune2	A	G	19: 17,125,043	E2522G	probably damaging	Het
Radil	T	C	5: 142,495,406	T549A	possibly damaging	Het
Rasa2	G	A	9: 96,611,473	L53F	possibly damaging	Het
Rasgrf2	A	G	13: 92,029,075	F306L	probably damaging	Het
Rbm19	C	T	5: 120,133,010	R633C	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Slc4a4	T	A	5: 89,132,507	L353H	probably damaging	Het
Slc4a4	T	C	5: 89,225,948	V971A	probably damaging	Het
Stil	T	A	4: 115,014,069		probably benign	Het
Tjp3	T	C	10: 81,280,507	K251R	probably benign	Het
Ugt2b35	A	T	5: 87,001,598	Y236F	probably benign	Het
Utp14b	T	A	1: 78,664,725	D113E	possibly damaging	Het
Vmn1r121	G	A	7: 21,098,465	Q17*	probably null	Het
Vmn2r28	A	T	7: 5,481,392	L603Q	probably damaging	Het
Vps13b	A	G	15: 35,646,361	E1537G	probably damaging	Het
Xrcc4	T	C	13: 90,062,077	T83A	probably benign	Het
Yae1d1	T	C	13: 17,993,242	E22G	probably damaging	Het

Other mutations in Olfr875

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01909:Olfr875	APN	9	37772863	missense	possibly damaging	0.95
IGL02013:Olfr875	APN	9	37772889	missense	probably benign	0.00
IGL02162:Olfr875	APN	9	37772931	missense	probably benign	0.13
IGL02966:Olfr875	APN	9	37773586	missense	probably benign	0.28
R0017:Olfr875	UTSW	9	37772978	missense	probably benign	0.08
R0520:Olfr875	UTSW	9	37773553	missense	probably benign	0.00
R0553:Olfr875	UTSW	9	37773331	missense	probably benign	0.05
R0833:Olfr875	UTSW	9	37773076	missense	probably benign	0.03
R1316:Olfr875	UTSW	9	37772743	missense	possibly damaging	0.94
R1547:Olfr875	UTSW	9	37772664	missense	probably benign	0.00
R1888:Olfr875	UTSW	9	37772867	missense	possibly damaging	0.88
R1888:Olfr875	UTSW	9	37772867	missense	possibly damaging	0.88
R1891:Olfr875	UTSW	9	37772867	missense	possibly damaging	0.88
R1894:Olfr875	UTSW	9	37772867	missense	possibly damaging	0.88
R4816:Olfr875	UTSW	9	37773430	missense	possibly damaging	0.72
R4829:Olfr875	UTSW	9	37772947	missense	probably damaging	1.00
R4952:Olfr875	UTSW	9	37773064	missense	probably damaging	0.99
R6111:Olfr875	UTSW	9	37772932	missense	probably damaging	0.99
R6838:Olfr875	UTSW	9	37773052	missense	possibly damaging	0.87
R7101:Olfr875	UTSW	9	37772991	missense	probably damaging	0.99
R7104:Olfr875	UTSW	9	37773141	missense	possibly damaging	0.64
R7224:Olfr875	UTSW	9	37773415	missense	possibly damaging	0.95
R7334:Olfr875	UTSW	9	37772997	missense	probably damaging	0.97
R7582:Olfr875	UTSW	9	37772821	missense	probably damaging	1.00
R7909:Olfr875	UTSW	9	37772737	missense	probably damaging	1.00
R8498:Olfr875	UTSW	9	37773264	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCTGTCAGCCATGGCATATG -3'
(R):5'- ACAATCAAGTGGGAGCTGC -3'

Sequencing Primer
(F):5'- CAGCCATGGCATATGACCGTTATG -3'
(R):5'- TGCTGAAAGCCTTGGACCTG -3'

Posted On

2015-02-05