Incidental Mutation 'R3055:Olfr875'
ID 265131
Institutional Source Beutler Lab
Gene Symbol Olfr875
Ensembl Gene ENSMUSG00000058628
Gene Name olfactory receptor 875
Synonyms GA_x6K02T2PVTD-31458511-31459443, MOR161-4
MMRRC Submission 040564-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock # R3055 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 37771857-37774459 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 37773193 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 178 (C178F)
Ref Sequence ENSEMBL: ENSMUSP00000150684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080634] [ENSMUST00000215128]
AlphaFold Q7TRE5
Predicted Effect probably damaging
Transcript: ENSMUST00000080634
AA Change: C178F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079467
Gene: ENSMUSG00000058628
AA Change: C178F

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 1.1e-48 PFAM
Pfam:7tm_1 40 289 1.8e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215128
AA Change: C178F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.5014 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610042L04Rik A G 14: 4,348,878 E13G probably damaging Het
5730596B20Rik A T 6: 52,179,128 probably benign Het
A230050P20Rik AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA 9: 20,873,717 probably benign Het
Abca16 A G 7: 120,435,851 M287V probably benign Het
Abca7 G A 10: 79,999,747 R283H probably damaging Het
Acad11 A G 9: 104,076,336 I126V probably damaging Het
Ahrr A G 13: 74,224,887 V148A probably damaging Het
Aldh1l2 T C 10: 83,502,472 K528E probably benign Het
Atp6v0a2 T A 5: 124,627,144 probably benign Het
Atxn10 A G 15: 85,387,005 D248G probably benign Het
Bard1 A G 1: 71,088,231 V73A possibly damaging Het
Catsper3 T C 13: 55,808,896 S376P unknown Het
Ccdc150 A G 1: 54,288,842 N361S possibly damaging Het
Cxcr6 A T 9: 123,810,464 I177F probably damaging Het
D330045A20Rik T A X: 139,511,557 V439E possibly damaging Het
Ddx25 A G 9: 35,551,351 V246A probably damaging Het
Drd4 T C 7: 141,294,479 V319A probably damaging Het
Dscam G A 16: 96,801,355 T629I probably damaging Het
Evi5l C T 8: 4,191,603 R311* probably null Het
Fxr1 A G 3: 34,049,184 E221G probably damaging Het
Gldn A T 9: 54,338,523 T453S probably damaging Het
Gm436 A G 4: 144,674,698 I72T probably benign Het
Ighm T A 12: 113,418,976 probably benign Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Lgr5 T A 10: 115,466,123 probably benign Het
Mier3 T A 13: 111,691,303 D7E probably damaging Het
Mms19 A T 19: 41,950,088 probably benign Het
Mrpl20 G T 4: 155,803,872 V43F possibly damaging Het
Muc5b G T 7: 141,864,041 V3575F probably damaging Het
Naip5 T C 13: 100,221,878 Y950C probably benign Het
Olfr1094 T C 2: 86,829,127 F125S possibly damaging Het
Olfr463 A G 11: 87,893,372 V184A possibly damaging Het
Pkd1l2 T A 8: 117,068,315 probably null Het
Prune2 A G 19: 17,125,043 E2522G probably damaging Het
Radil T C 5: 142,495,406 T549A possibly damaging Het
Rasa2 G A 9: 96,611,473 L53F possibly damaging Het
Rasgrf2 A G 13: 92,029,075 F306L probably damaging Het
Rbm19 C T 5: 120,133,010 R633C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc4a4 T A 5: 89,132,507 L353H probably damaging Het
Slc4a4 T C 5: 89,225,948 V971A probably damaging Het
Stil T A 4: 115,014,069 probably benign Het
Tjp3 T C 10: 81,280,507 K251R probably benign Het
Ugt2b35 A T 5: 87,001,598 Y236F probably benign Het
Utp14b T A 1: 78,664,725 D113E possibly damaging Het
Vmn1r121 G A 7: 21,098,465 Q17* probably null Het
Vmn2r28 A T 7: 5,481,392 L603Q probably damaging Het
Vps13b A G 15: 35,646,361 E1537G probably damaging Het
Xrcc4 T C 13: 90,062,077 T83A probably benign Het
Yae1d1 T C 13: 17,993,242 E22G probably damaging Het
Other mutations in Olfr875
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01909:Olfr875 APN 9 37772863 missense possibly damaging 0.95
IGL02013:Olfr875 APN 9 37772889 missense probably benign 0.00
IGL02162:Olfr875 APN 9 37772931 missense probably benign 0.13
IGL02966:Olfr875 APN 9 37773586 missense probably benign 0.28
R0017:Olfr875 UTSW 9 37772978 missense probably benign 0.08
R0520:Olfr875 UTSW 9 37773553 missense probably benign 0.00
R0553:Olfr875 UTSW 9 37773331 missense probably benign 0.05
R0833:Olfr875 UTSW 9 37773076 missense probably benign 0.03
R1316:Olfr875 UTSW 9 37772743 missense possibly damaging 0.94
R1547:Olfr875 UTSW 9 37772664 missense probably benign 0.00
R1888:Olfr875 UTSW 9 37772867 missense possibly damaging 0.88
R1888:Olfr875 UTSW 9 37772867 missense possibly damaging 0.88
R1891:Olfr875 UTSW 9 37772867 missense possibly damaging 0.88
R1894:Olfr875 UTSW 9 37772867 missense possibly damaging 0.88
R4816:Olfr875 UTSW 9 37773430 missense possibly damaging 0.72
R4829:Olfr875 UTSW 9 37772947 missense probably damaging 1.00
R4952:Olfr875 UTSW 9 37773064 missense probably damaging 0.99
R6111:Olfr875 UTSW 9 37772932 missense probably damaging 0.99
R6838:Olfr875 UTSW 9 37773052 missense possibly damaging 0.87
R7101:Olfr875 UTSW 9 37772991 missense probably damaging 0.99
R7104:Olfr875 UTSW 9 37773141 missense possibly damaging 0.64
R7224:Olfr875 UTSW 9 37773415 missense possibly damaging 0.95
R7334:Olfr875 UTSW 9 37772997 missense probably damaging 0.97
R7582:Olfr875 UTSW 9 37772821 missense probably damaging 1.00
R7909:Olfr875 UTSW 9 37772737 missense probably damaging 1.00
R8498:Olfr875 UTSW 9 37773264 missense probably damaging 1.00
R9158:Olfr875 UTSW 9 37773504 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGTCAGCCATGGCATATG -3'
(R):5'- ACAATCAAGTGGGAGCTGC -3'

Sequencing Primer
(F):5'- CAGCCATGGCATATGACCGTTATG -3'
(R):5'- TGCTGAAAGCCTTGGACCTG -3'
Posted On 2015-02-05