Incidental Mutation 'R3055:Rasa2'
ID265133
Institutional Source Beutler Lab
Gene Symbol Rasa2
Ensembl Gene ENSMUSG00000032413
Gene NameRAS p21 protein activator 2
SynonymsGAP1m, 5430433H21Rik
MMRRC Submission 040564-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R3055 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location96539300-96631617 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 96611473 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 53 (L53F)
Ref Sequence ENSEMBL: ENSMUSP00000034984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034984] [ENSMUST00000128346]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034984
AA Change: L53F

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000034984
Gene: ENSMUSG00000032413
AA Change: L53F

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
C2 38 136 3.78e-16 SMART
C2 171 287 8.48e-19 SMART
RasGAP 300 641 7.05e-140 SMART
PH 604 706 1.98e-17 SMART
BTK 706 742 1.39e-18 SMART
low complexity region 824 838 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000128346
SMART Domains Protein: ENSMUSP00000115629
Gene: ENSMUSG00000032413

DomainStartEndE-ValueType
C2 3 79 6.86e-5 SMART
C2 114 230 8.48e-19 SMART
RasGAP 243 584 7.05e-140 SMART
Meta Mutation Damage Score 0.0837 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is member of the GAP1 family of GTPase-activating proteins. The gene product stimulates the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610042L04Rik A G 14: 4,348,878 E13G probably damaging Het
5730596B20Rik A T 6: 52,179,128 probably benign Het
A230050P20Rik AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA 9: 20,873,717 probably benign Het
Abca16 A G 7: 120,435,851 M287V probably benign Het
Abca7 G A 10: 79,999,747 R283H probably damaging Het
Acad11 A G 9: 104,076,336 I126V probably damaging Het
Ahrr A G 13: 74,224,887 V148A probably damaging Het
Aldh1l2 T C 10: 83,502,472 K528E probably benign Het
Atp6v0a2 T A 5: 124,627,144 probably benign Het
Atxn10 A G 15: 85,387,005 D248G probably benign Het
Bard1 A G 1: 71,088,231 V73A possibly damaging Het
Catsper3 T C 13: 55,808,896 S376P unknown Het
Ccdc150 A G 1: 54,288,842 N361S possibly damaging Het
Cxcr6 A T 9: 123,810,464 I177F probably damaging Het
D330045A20Rik T A X: 139,511,557 V439E possibly damaging Het
Ddx25 A G 9: 35,551,351 V246A probably damaging Het
Drd4 T C 7: 141,294,479 V319A probably damaging Het
Dscam G A 16: 96,801,355 T629I probably damaging Het
Evi5l C T 8: 4,191,603 R311* probably null Het
Fxr1 A G 3: 34,049,184 E221G probably damaging Het
Gldn A T 9: 54,338,523 T453S probably damaging Het
Gm436 A G 4: 144,674,698 I72T probably benign Het
Ighm T A 12: 113,418,976 probably benign Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Lgr5 T A 10: 115,466,123 probably benign Het
Mier3 T A 13: 111,691,303 D7E probably damaging Het
Mms19 A T 19: 41,950,088 probably benign Het
Mrpl20 G T 4: 155,803,872 V43F possibly damaging Het
Muc5b G T 7: 141,864,041 V3575F probably damaging Het
Naip5 T C 13: 100,221,878 Y950C probably benign Het
Olfr1094 T C 2: 86,829,127 F125S possibly damaging Het
Olfr463 A G 11: 87,893,372 V184A possibly damaging Het
Olfr875 G T 9: 37,773,193 C178F probably damaging Het
Pkd1l2 T A 8: 117,068,315 probably null Het
Prune2 A G 19: 17,125,043 E2522G probably damaging Het
Radil T C 5: 142,495,406 T549A possibly damaging Het
Rasgrf2 A G 13: 92,029,075 F306L probably damaging Het
Rbm19 C T 5: 120,133,010 R633C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc4a4 T A 5: 89,132,507 L353H probably damaging Het
Slc4a4 T C 5: 89,225,948 V971A probably damaging Het
Stil T A 4: 115,014,069 probably benign Het
Tjp3 T C 10: 81,280,507 K251R probably benign Het
Ugt2b35 A T 5: 87,001,598 Y236F probably benign Het
Utp14b T A 1: 78,664,725 D113E possibly damaging Het
Vmn1r121 G A 7: 21,098,465 Q17* probably null Het
Vmn2r28 A T 7: 5,481,392 L603Q probably damaging Het
Vps13b A G 15: 35,646,361 E1537G probably damaging Het
Xrcc4 T C 13: 90,062,077 T83A probably benign Het
Yae1d1 T C 13: 17,993,242 E22G probably damaging Het
Other mutations in Rasa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Rasa2 APN 9 96544860 missense probably damaging 1.00
IGL00661:Rasa2 APN 9 96577553 splice site probably benign
IGL00825:Rasa2 APN 9 96570719 missense probably benign 0.37
IGL01645:Rasa2 APN 9 96582781 nonsense probably null
IGL02260:Rasa2 APN 9 96544319 missense probably benign 0.08
IGL02568:Rasa2 APN 9 96580510 missense probably damaging 1.00
IGL02963:Rasa2 APN 9 96570785 missense probably damaging 1.00
R0018:Rasa2 UTSW 9 96571963 missense probably damaging 1.00
R0018:Rasa2 UTSW 9 96571963 missense probably damaging 1.00
R0144:Rasa2 UTSW 9 96592019 missense probably damaging 0.99
R0238:Rasa2 UTSW 9 96568407 missense probably damaging 1.00
R0238:Rasa2 UTSW 9 96568407 missense probably damaging 1.00
R0295:Rasa2 UTSW 9 96545810 splice site probably null
R0332:Rasa2 UTSW 9 96606176 missense probably damaging 1.00
R0348:Rasa2 UTSW 9 96571959 missense probably damaging 1.00
R0931:Rasa2 UTSW 9 96552404 missense possibly damaging 0.88
R1067:Rasa2 UTSW 9 96552323 missense probably damaging 1.00
R1485:Rasa2 UTSW 9 96544348 missense probably benign 0.00
R1562:Rasa2 UTSW 9 96545750 missense possibly damaging 0.89
R1698:Rasa2 UTSW 9 96568375 missense possibly damaging 0.56
R1980:Rasa2 UTSW 9 96570768 missense probably damaging 0.99
R4175:Rasa2 UTSW 9 96560777 missense probably benign 0.01
R4258:Rasa2 UTSW 9 96557380 intron probably benign
R4432:Rasa2 UTSW 9 96542407 unclassified probably benign
R4636:Rasa2 UTSW 9 96544337 missense probably benign
R4773:Rasa2 UTSW 9 96544417 missense probably benign
R4990:Rasa2 UTSW 9 96591989 missense probably benign 0.24
R5177:Rasa2 UTSW 9 96544791 nonsense probably null
R5462:Rasa2 UTSW 9 96571918 missense probably damaging 1.00
R5737:Rasa2 UTSW 9 96570665 critical splice donor site probably null
R5775:Rasa2 UTSW 9 96577468 splice site probably null
R5866:Rasa2 UTSW 9 96545770 missense probably benign 0.00
R5938:Rasa2 UTSW 9 96611389 missense possibly damaging 0.50
R6076:Rasa2 UTSW 9 96545646 missense probably benign
R6216:Rasa2 UTSW 9 96544304 missense probably damaging 1.00
R6743:Rasa2 UTSW 9 96611440 missense probably damaging 1.00
R6982:Rasa2 UTSW 9 96560750 missense probably damaging 1.00
R7350:Rasa2 UTSW 9 96544355 missense probably benign 0.16
R7405:Rasa2 UTSW 9 96566027 missense probably benign 0.09
R7421:Rasa2 UTSW 9 96611447 missense unknown
R7490:Rasa2 UTSW 9 96566122 missense possibly damaging 0.48
R7515:Rasa2 UTSW 9 96552300 splice site probably null
R7547:Rasa2 UTSW 9 96611421 missense probably damaging 1.00
R7557:Rasa2 UTSW 9 96557425 missense probably damaging 0.98
R7821:Rasa2 UTSW 9 96580484 splice site probably null
R7894:Rasa2 UTSW 9 96602727 missense probably benign 0.13
R7977:Rasa2 UTSW 9 96602727 missense probably benign 0.13
RF017:Rasa2 UTSW 9 96631468 small insertion probably benign
RF029:Rasa2 UTSW 9 96631467 small insertion probably benign
RF047:Rasa2 UTSW 9 96631467 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AAGCACTTCACTGGGGTCAC -3'
(R):5'- TCTCAGGAAAGTTCACCACC -3'

Sequencing Primer
(F):5'- CAGCCTACTTAGGAGGTGTGAACTTC -3'
(R):5'- GGAAAGTTCACCACCTTTTAGC -3'
Posted On2015-02-05