Incidental Mutation 'R3055:Tjp3'
ID265136
Institutional Source Beutler Lab
Gene Symbol Tjp3
Ensembl Gene ENSMUSG00000034917
Gene Nametight junction protein 3
SynonymsZO-3
MMRRC Submission 040564-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3055 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location81273207-81291581 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81280507 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 251 (K251R)
Ref Sequence ENSEMBL: ENSMUSP00000151601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045744] [ENSMUST00000218484] [ENSMUST00000219479]
Predicted Effect probably benign
Transcript: ENSMUST00000045744
AA Change: K251R

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000036438
Gene: ENSMUSG00000034917
AA Change: K251R

DomainStartEndE-ValueType
PDZ 20 93 2.81e-18 SMART
low complexity region 119 162 N/A INTRINSIC
PDZ 196 264 2.71e-11 SMART
low complexity region 297 305 N/A INTRINSIC
PDZ 378 451 4.97e-19 SMART
SH3 466 539 9.96e-2 SMART
low complexity region 548 559 N/A INTRINSIC
GuKc 570 756 6.9e-46 SMART
Blast:GuKc 767 898 9e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000218484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218966
Predicted Effect probably benign
Transcript: ENSMUST00000219479
AA Change: K251R

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219958
Meta Mutation Damage Score 0.0697 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the membrane-associated guanylate kinase-like (MAGUK) protein family which is characterized by members having multiple PDZ domains, a single SH3 domain, and a single guanylate kinase-like (GUK)-domain. In addition, members of the zonula occludens protein subfamily have an acidic domain, a basic arginine-rich region, and a proline-rich domain. The protein encoded by this gene plays a role in the linkage between the actin cytoskeleton and tight-junctions and also sequesters cyclin D1 at tight junctions during mitosis. Alternative splicing results in multiple transcript variants encoding distinct isoforms. This gene has a partial pseudogene on chromosome 1. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygous mutation of this gene results in viable and fertile mice with no abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610042L04Rik A G 14: 4,348,878 E13G probably damaging Het
5730596B20Rik A T 6: 52,179,128 probably benign Het
A230050P20Rik AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA 9: 20,873,717 probably benign Het
Abca16 A G 7: 120,435,851 M287V probably benign Het
Abca7 G A 10: 79,999,747 R283H probably damaging Het
Acad11 A G 9: 104,076,336 I126V probably damaging Het
Ahrr A G 13: 74,224,887 V148A probably damaging Het
Aldh1l2 T C 10: 83,502,472 K528E probably benign Het
Atp6v0a2 T A 5: 124,627,144 probably benign Het
Atxn10 A G 15: 85,387,005 D248G probably benign Het
Bard1 A G 1: 71,088,231 V73A possibly damaging Het
Catsper3 T C 13: 55,808,896 S376P unknown Het
Ccdc150 A G 1: 54,288,842 N361S possibly damaging Het
Cxcr6 A T 9: 123,810,464 I177F probably damaging Het
D330045A20Rik T A X: 139,511,557 V439E possibly damaging Het
Ddx25 A G 9: 35,551,351 V246A probably damaging Het
Drd4 T C 7: 141,294,479 V319A probably damaging Het
Dscam G A 16: 96,801,355 T629I probably damaging Het
Evi5l C T 8: 4,191,603 R311* probably null Het
Fxr1 A G 3: 34,049,184 E221G probably damaging Het
Gldn A T 9: 54,338,523 T453S probably damaging Het
Gm436 A G 4: 144,674,698 I72T probably benign Het
Ighm T A 12: 113,418,976 probably benign Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Lgr5 T A 10: 115,466,123 probably benign Het
Mier3 T A 13: 111,691,303 D7E probably damaging Het
Mms19 A T 19: 41,950,088 probably benign Het
Mrpl20 G T 4: 155,803,872 V43F possibly damaging Het
Muc5b G T 7: 141,864,041 V3575F probably damaging Het
Naip5 T C 13: 100,221,878 Y950C probably benign Het
Olfr1094 T C 2: 86,829,127 F125S possibly damaging Het
Olfr463 A G 11: 87,893,372 V184A possibly damaging Het
Olfr875 G T 9: 37,773,193 C178F probably damaging Het
Pkd1l2 T A 8: 117,068,315 probably null Het
Prune2 A G 19: 17,125,043 E2522G probably damaging Het
Radil T C 5: 142,495,406 T549A possibly damaging Het
Rasa2 G A 9: 96,611,473 L53F possibly damaging Het
Rasgrf2 A G 13: 92,029,075 F306L probably damaging Het
Rbm19 C T 5: 120,133,010 R633C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc4a4 T A 5: 89,132,507 L353H probably damaging Het
Slc4a4 T C 5: 89,225,948 V971A probably damaging Het
Stil T A 4: 115,014,069 probably benign Het
Ugt2b35 A T 5: 87,001,598 Y236F probably benign Het
Utp14b T A 1: 78,664,725 D113E possibly damaging Het
Vmn1r121 G A 7: 21,098,465 Q17* probably null Het
Vmn2r28 A T 7: 5,481,392 L603Q probably damaging Het
Vps13b A G 15: 35,646,361 E1537G probably damaging Het
Xrcc4 T C 13: 90,062,077 T83A probably benign Het
Yae1d1 T C 13: 17,993,242 E22G probably damaging Het
Other mutations in Tjp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Tjp3 APN 10 81273865 missense probably benign
IGL01739:Tjp3 APN 10 81278656 missense probably benign 0.09
IGL02826:Tjp3 APN 10 81273689 missense probably damaging 0.98
IGL03145:Tjp3 APN 10 81283688 missense probably benign 0.05
PIT4480001:Tjp3 UTSW 10 81279257 missense probably damaging 1.00
R0561:Tjp3 UTSW 10 81273840 missense probably benign
R0562:Tjp3 UTSW 10 81280555 missense probably damaging 0.99
R1099:Tjp3 UTSW 10 81273823 missense probably benign
R1618:Tjp3 UTSW 10 81276260 unclassified probably benign
R1786:Tjp3 UTSW 10 81278054 missense possibly damaging 0.52
R1955:Tjp3 UTSW 10 81277999 missense probably damaging 1.00
R2107:Tjp3 UTSW 10 81280544 missense possibly damaging 0.67
R2130:Tjp3 UTSW 10 81278054 missense possibly damaging 0.52
R2131:Tjp3 UTSW 10 81278054 missense possibly damaging 0.52
R2132:Tjp3 UTSW 10 81278054 missense possibly damaging 0.52
R2133:Tjp3 UTSW 10 81278054 missense possibly damaging 0.52
R2178:Tjp3 UTSW 10 81280107 missense probably benign 0.17
R3054:Tjp3 UTSW 10 81280507 missense probably benign 0.13
R5470:Tjp3 UTSW 10 81279547 missense probably benign 0.04
R5645:Tjp3 UTSW 10 81278620 splice site probably null
R5918:Tjp3 UTSW 10 81277912 missense probably benign 0.01
R6108:Tjp3 UTSW 10 81281146 missense probably benign
R6245:Tjp3 UTSW 10 81277276 missense probably benign 0.02
R6300:Tjp3 UTSW 10 81281117 nonsense probably null
R7686:Tjp3 UTSW 10 81278051 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCGGCTCTAAGTCAGTTCC -3'
(R):5'- TTACAGGTGAGCCCAGGTTC -3'

Sequencing Primer
(F):5'- GGCTCTAAGTCAGTTCCCATCC -3'
(R):5'- TGAGCCCAGGTTCATGCTG -3'
Posted On2015-02-05