Mutagenetix > Incidental Mutation

Incidental Mutation 'R3055:Aldh1l2'

265137

Institutional Source

Beutler Lab

Gene Symbol

Aldh1l2

Ensembl Gene

ENSMUSG00000020256

Gene Name

aldehyde dehydrogenase 1 family, member L2

Synonyms

MMRRC Submission

040564-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3055 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83487450-83534140 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 83502472 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 528 (K528E)

Ref Sequence

ENSEMBL: ENSMUSP00000117076 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020497] [ENSMUST00000146640]

AlphaFold

Q8K009

Predicted Effect

probably benign
Transcript: ENSMUST00000020497
AA Change: K641E

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000020497
Gene: ENSMUSG00000020256
AA Change: K641E

Domain	Start	End	E-Value	Type
Pfam:Formyl_trans_N	23	202	5e-46	PFAM
Pfam:Formyl_trans_C	226	330	1.3e-16	PFAM
Pfam:PP-binding	346	412	9.6e-7	PFAM
Pfam:Aldedh	451	919	3.4e-174	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125193

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138858

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141184

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143793

Predicted Effect

probably benign
Transcript: ENSMUST00000146640
AA Change: K528E

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000117076
Gene: ENSMUSG00000020256
AA Change: K528E

Domain	Start	End	E-Value	Type
Pfam:Formyl_trans_N	1	89	2.8e-30	PFAM
Pfam:Formyl_trans_C	113	217	1.1e-16	PFAM
Pfam:PP-binding	233	299	1.5e-8	PFAM
Pfam:Aldedh	338	806	8.5e-175	PFAM

Meta Mutation Damage Score

0.1296

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of both the aldehyde dehydrogenase superfamily and the formyl transferase superfamily. This member is the mitochondrial form of 10-formyltetrahydrofolate dehydrogenase (FDH), which converts 10-formyltetrahydrofolate to tetrahydrofolate and CO2 in an NADP(+)-dependent reaction, and plays an essential role in the distribution of one-carbon groups between the cytosolic and mitochondrial compartments of the cell. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2010]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610042L04Rik	A	G	14: 4,348,878	E13G	probably damaging	Het
5730596B20Rik	A	T	6: 52,179,128		probably benign	Het
A230050P20Rik	AGAGGAGGAGGAGGAGGAGGAGGAGGA	AGAGGAGGAGGAGGAGGAGGAGGA	9: 20,873,717		probably benign	Het
Abca16	A	G	7: 120,435,851	M287V	probably benign	Het
Abca7	G	A	10: 79,999,747	R283H	probably damaging	Het
Acad11	A	G	9: 104,076,336	I126V	probably damaging	Het
Ahrr	A	G	13: 74,224,887	V148A	probably damaging	Het
Atp6v0a2	T	A	5: 124,627,144		probably benign	Het
Atxn10	A	G	15: 85,387,005	D248G	probably benign	Het
Bard1	A	G	1: 71,088,231	V73A	possibly damaging	Het
Catsper3	T	C	13: 55,808,896	S376P	unknown	Het
Ccdc150	A	G	1: 54,288,842	N361S	possibly damaging	Het
Cxcr6	A	T	9: 123,810,464	I177F	probably damaging	Het
D330045A20Rik	T	A	X: 139,511,557	V439E	possibly damaging	Het
Ddx25	A	G	9: 35,551,351	V246A	probably damaging	Het
Drd4	T	C	7: 141,294,479	V319A	probably damaging	Het
Dscam	G	A	16: 96,801,355	T629I	probably damaging	Het
Evi5l	C	T	8: 4,191,603	R311*	probably null	Het
Fxr1	A	G	3: 34,049,184	E221G	probably damaging	Het
Gldn	A	T	9: 54,338,523	T453S	probably damaging	Het
Gm436	A	G	4: 144,674,698	I72T	probably benign	Het
Ighm	T	A	12: 113,418,976		probably benign	Het
Ints12	G	A	3: 133,109,365	M444I	possibly damaging	Het
Lgr5	T	A	10: 115,466,123		probably benign	Het
Mier3	T	A	13: 111,691,303	D7E	probably damaging	Het
Mms19	A	T	19: 41,950,088		probably benign	Het
Mrpl20	G	T	4: 155,803,872	V43F	possibly damaging	Het
Muc5b	G	T	7: 141,864,041	V3575F	probably damaging	Het
Naip5	T	C	13: 100,221,878	Y950C	probably benign	Het
Olfr1094	T	C	2: 86,829,127	F125S	possibly damaging	Het
Olfr463	A	G	11: 87,893,372	V184A	possibly damaging	Het
Olfr875	G	T	9: 37,773,193	C178F	probably damaging	Het
Pkd1l2	T	A	8: 117,068,315		probably null	Het
Prune2	A	G	19: 17,125,043	E2522G	probably damaging	Het
Radil	T	C	5: 142,495,406	T549A	possibly damaging	Het
Rasa2	G	A	9: 96,611,473	L53F	possibly damaging	Het
Rasgrf2	A	G	13: 92,029,075	F306L	probably damaging	Het
Rbm19	C	T	5: 120,133,010	R633C	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Slc4a4	T	A	5: 89,132,507	L353H	probably damaging	Het
Slc4a4	T	C	5: 89,225,948	V971A	probably damaging	Het
Stil	T	A	4: 115,014,069		probably benign	Het
Tjp3	T	C	10: 81,280,507	K251R	probably benign	Het
Ugt2b35	A	T	5: 87,001,598	Y236F	probably benign	Het
Utp14b	T	A	1: 78,664,725	D113E	possibly damaging	Het
Vmn1r121	G	A	7: 21,098,465	Q17*	probably null	Het
Vmn2r28	A	T	7: 5,481,392	L603Q	probably damaging	Het
Vps13b	A	G	15: 35,646,361	E1537G	probably damaging	Het
Xrcc4	T	C	13: 90,062,077	T83A	probably benign	Het
Yae1d1	T	C	13: 17,993,242	E22G	probably damaging	Het

Other mutations in Aldh1l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01152:Aldh1l2	APN	10	83522886	nonsense	probably null
IGL01154:Aldh1l2	APN	10	83520373	missense	probably damaging	1.00
IGL01301:Aldh1l2	APN	10	83522846	missense	probably damaging	1.00
IGL01354:Aldh1l2	APN	10	83527376	missense	probably damaging	1.00
IGL01364:Aldh1l2	APN	10	83492667	missense	probably damaging	1.00
IGL01445:Aldh1l2	APN	10	83520262	splice site	probably benign
IGL02179:Aldh1l2	APN	10	83522837	missense	probably benign	0.10
IGL02283:Aldh1l2	APN	10	83495895	missense	probably benign	0.00
IGL02507:Aldh1l2	APN	10	83492584	nonsense	probably null
IGL02727:Aldh1l2	APN	10	83506605	missense	probably damaging	1.00
IGL03353:Aldh1l2	APN	10	83522913	missense	probably benign	0.17
Hunger_winter	UTSW	10	83508013	critical splice donor site	probably null
Spartan	UTSW	10	83512306	missense	possibly damaging	0.93
ANU18:Aldh1l2	UTSW	10	83522846	missense	probably damaging	1.00
IGL02984:Aldh1l2	UTSW	10	83527335	missense	probably damaging	1.00
R0267:Aldh1l2	UTSW	10	83522687	splice site	probably benign
R0302:Aldh1l2	UTSW	10	83520365	missense	probably damaging	1.00
R0349:Aldh1l2	UTSW	10	83490614	missense	probably damaging	1.00
R0468:Aldh1l2	UTSW	10	83518678	missense	probably benign	0.01
R0745:Aldh1l2	UTSW	10	83518630	splice site	probably null
R0788:Aldh1l2	UTSW	10	83516164	missense	probably damaging	1.00
R1117:Aldh1l2	UTSW	10	83508623	missense	probably benign	0.01
R1241:Aldh1l2	UTSW	10	83496025	missense	probably benign	0.00
R1420:Aldh1l2	UTSW	10	83495935	missense	probably damaging	1.00
R1490:Aldh1l2	UTSW	10	83520370	missense	probably damaging	1.00
R1704:Aldh1l2	UTSW	10	83508660	missense	probably benign	0.10
R1729:Aldh1l2	UTSW	10	83508082	nonsense	probably null
R1893:Aldh1l2	UTSW	10	83492536	missense	probably damaging	1.00
R1897:Aldh1l2	UTSW	10	83502525	missense	probably damaging	1.00
R2047:Aldh1l2	UTSW	10	83506743	missense	probably damaging	1.00
R2290:Aldh1l2	UTSW	10	83527313	missense	probably damaging	1.00
R3054:Aldh1l2	UTSW	10	83502472	missense	probably benign	0.14
R4097:Aldh1l2	UTSW	10	83512364	missense	probably damaging	0.98
R4162:Aldh1l2	UTSW	10	83506654	missense	possibly damaging	0.50
R4295:Aldh1l2	UTSW	10	83495920	missense	possibly damaging	0.62
R4296:Aldh1l2	UTSW	10	83522777	missense	probably benign	0.34
R4388:Aldh1l2	UTSW	10	83513622	missense	probably damaging	1.00
R4809:Aldh1l2	UTSW	10	83506632	missense	probably damaging	1.00
R5052:Aldh1l2	UTSW	10	83508692	missense	possibly damaging	0.92
R5421:Aldh1l2	UTSW	10	83527407	missense	probably damaging	1.00
R5491:Aldh1l2	UTSW	10	83522785	missense	probably benign	0.00
R5688:Aldh1l2	UTSW	10	83501925	missense	possibly damaging	0.93
R5726:Aldh1l2	UTSW	10	83512306	missense	possibly damaging	0.93
R5737:Aldh1l2	UTSW	10	83520325	missense	probably damaging	1.00
R5752:Aldh1l2	UTSW	10	83520380	missense	probably damaging	1.00
R6113:Aldh1l2	UTSW	10	83508134	nonsense	probably null
R6161:Aldh1l2	UTSW	10	83520338	missense	probably benign	0.00
R6166:Aldh1l2	UTSW	10	83493424	splice site	probably null
R6189:Aldh1l2	UTSW	10	83508013	critical splice donor site	probably null
R7357:Aldh1l2	UTSW	10	83514544	missense	possibly damaging	0.89
R7394:Aldh1l2	UTSW	10	83502457	missense	probably damaging	1.00
R7469:Aldh1l2	UTSW	10	83508105	missense	probably damaging	1.00
R7676:Aldh1l2	UTSW	10	83508111	missense	probably benign
R7848:Aldh1l2	UTSW	10	83499843	missense	probably benign	0.12
R7958:Aldh1l2	UTSW	10	83520338	missense	probably benign	0.00
R8311:Aldh1l2	UTSW	10	83490615	missense	probably damaging	1.00
R8477:Aldh1l2	UTSW	10	83501921	missense	probably damaging	1.00
R8730:Aldh1l2	UTSW	10	83506642	missense	possibly damaging	0.94
R8884:Aldh1l2	UTSW	10	83508677	missense	probably benign	0.02
R9117:Aldh1l2	UTSW	10	83506681	missense	probably benign	0.41
R9239:Aldh1l2	UTSW	10	83506632	missense	probably damaging	1.00
R9335:Aldh1l2	UTSW	10	83506646	missense	probably damaging	0.96
R9368:Aldh1l2	UTSW	10	83495952	nonsense	probably null
R9784:Aldh1l2	UTSW	10	83506750	critical splice acceptor site	probably null
Z1177:Aldh1l2	UTSW	10	83493480	missense	probably damaging	1.00
Z1177:Aldh1l2	UTSW	10	83534005	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCACAGTAAGTATATTGATGCTTGG -3'
(R):5'- GACCTTTGTGACCATTGGCC -3'

Sequencing Primer
(F):5'- AAGTATATTGATGCTTGGTGATCTG -3'
(R):5'- TGGTCTCCCAAGTCTGAGCAC -3'

Posted On

2015-02-05