Incidental Mutation 'R3055:Ahrr'
ID265143
Institutional Source Beutler Lab
Gene Symbol Ahrr
Ensembl Gene ENSMUSG00000021575
Gene Namearyl-hydrocarbon receptor repressor
Synonyms
MMRRC Submission 040564-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3055 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location74211118-74292331 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74224887 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 148 (V148A)
Ref Sequence ENSEMBL: ENSMUSP00000022059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022059] [ENSMUST00000109640]
Predicted Effect probably damaging
Transcript: ENSMUST00000022059
AA Change: V148A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022059
Gene: ENSMUSG00000021575
AA Change: V148A

DomainStartEndE-ValueType
HLH 32 86 1.1e-11 SMART
PAS 108 174 6.6e-14 SMART
low complexity region 236 250 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109640
AA Change: V20A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105268
Gene: ENSMUSG00000021575
AA Change: V20A

DomainStartEndE-ValueType
Blast:PAS 1 46 1e-27 BLAST
PDB:4M4X|B 1 142 2e-30 PDB
SCOP:d1jnua_ 2 63 7e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123058
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148438
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222649
Meta Mutation Damage Score 0.6161 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: This gene encodes a protein that represses aryl hydrocarbon receptor-dependent signaling. The encoded protein competes with the aryl hydrocarbon receptor transcription factor for heterodimerization with the aryl hydrocarbon receptor nuclear translocator protein and binding to xenobiotic response element (XRE) sequence in many genes. This protein is implicated in the regulation of cell growth and differentiation as well as mediating dioxin toxicity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased susceptibility to chemically induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610042L04Rik A G 14: 4,348,878 E13G probably damaging Het
5730596B20Rik A T 6: 52,179,128 probably benign Het
A230050P20Rik AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA 9: 20,873,717 probably benign Het
Abca16 A G 7: 120,435,851 M287V probably benign Het
Abca7 G A 10: 79,999,747 R283H probably damaging Het
Acad11 A G 9: 104,076,336 I126V probably damaging Het
Aldh1l2 T C 10: 83,502,472 K528E probably benign Het
Atp6v0a2 T A 5: 124,627,144 probably benign Het
Atxn10 A G 15: 85,387,005 D248G probably benign Het
Bard1 A G 1: 71,088,231 V73A possibly damaging Het
Catsper3 T C 13: 55,808,896 S376P unknown Het
Ccdc150 A G 1: 54,288,842 N361S possibly damaging Het
Cxcr6 A T 9: 123,810,464 I177F probably damaging Het
D330045A20Rik T A X: 139,511,557 V439E possibly damaging Het
Ddx25 A G 9: 35,551,351 V246A probably damaging Het
Drd4 T C 7: 141,294,479 V319A probably damaging Het
Dscam G A 16: 96,801,355 T629I probably damaging Het
Evi5l C T 8: 4,191,603 R311* probably null Het
Fxr1 A G 3: 34,049,184 E221G probably damaging Het
Gldn A T 9: 54,338,523 T453S probably damaging Het
Gm436 A G 4: 144,674,698 I72T probably benign Het
Ighm T A 12: 113,418,976 probably benign Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Lgr5 T A 10: 115,466,123 probably benign Het
Mier3 T A 13: 111,691,303 D7E probably damaging Het
Mms19 A T 19: 41,950,088 probably benign Het
Mrpl20 G T 4: 155,803,872 V43F possibly damaging Het
Muc5b G T 7: 141,864,041 V3575F probably damaging Het
Naip5 T C 13: 100,221,878 Y950C probably benign Het
Olfr1094 T C 2: 86,829,127 F125S possibly damaging Het
Olfr463 A G 11: 87,893,372 V184A possibly damaging Het
Olfr875 G T 9: 37,773,193 C178F probably damaging Het
Pkd1l2 T A 8: 117,068,315 probably null Het
Prune2 A G 19: 17,125,043 E2522G probably damaging Het
Radil T C 5: 142,495,406 T549A possibly damaging Het
Rasa2 G A 9: 96,611,473 L53F possibly damaging Het
Rasgrf2 A G 13: 92,029,075 F306L probably damaging Het
Rbm19 C T 5: 120,133,010 R633C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc4a4 T A 5: 89,132,507 L353H probably damaging Het
Slc4a4 T C 5: 89,225,948 V971A probably damaging Het
Stil T A 4: 115,014,069 probably benign Het
Tjp3 T C 10: 81,280,507 K251R probably benign Het
Ugt2b35 A T 5: 87,001,598 Y236F probably benign Het
Utp14b T A 1: 78,664,725 D113E possibly damaging Het
Vmn1r121 G A 7: 21,098,465 Q17* probably null Het
Vmn2r28 A T 7: 5,481,392 L603Q probably damaging Het
Vps13b A G 15: 35,646,361 E1537G probably damaging Het
Xrcc4 T C 13: 90,062,077 T83A probably benign Het
Yae1d1 T C 13: 17,993,242 E22G probably damaging Het
Other mutations in Ahrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02116:Ahrr APN 13 74220573 missense possibly damaging 0.52
IGL03143:Ahrr APN 13 74257495 nonsense probably null
calico_jack UTSW 13 74222912 missense possibly damaging 0.51
R0009:Ahrr UTSW 13 74283024 splice site probably benign
R0010:Ahrr UTSW 13 74283024 splice site probably benign
R0010:Ahrr UTSW 13 74283024 splice site probably benign
R0040:Ahrr UTSW 13 74283024 splice site probably benign
R0079:Ahrr UTSW 13 74283024 splice site probably benign
R0082:Ahrr UTSW 13 74283024 splice site probably benign
R0164:Ahrr UTSW 13 74283024 splice site probably benign
R0165:Ahrr UTSW 13 74283024 splice site probably benign
R0167:Ahrr UTSW 13 74283024 splice site probably benign
R0310:Ahrr UTSW 13 74283024 splice site probably benign
R0344:Ahrr UTSW 13 74214586 missense probably damaging 1.00
R0948:Ahrr UTSW 13 74213769 missense probably damaging 1.00
R1192:Ahrr UTSW 13 74214403 missense probably benign 0.00
R1438:Ahrr UTSW 13 74224868 nonsense probably null
R1532:Ahrr UTSW 13 74213707 missense probably benign 0.01
R1600:Ahrr UTSW 13 74214378 missense probably benign 0.00
R2302:Ahrr UTSW 13 74277661 missense probably damaging 1.00
R4683:Ahrr UTSW 13 74224766 splice site silent
R4717:Ahrr UTSW 13 74215766 missense probably benign 0.03
R4769:Ahrr UTSW 13 74214212 missense probably damaging 1.00
R5998:Ahrr UTSW 13 74213836 missense probably damaging 0.99
R6225:Ahrr UTSW 13 74222912 missense possibly damaging 0.51
R7156:Ahrr UTSW 13 74229916 missense probably damaging 1.00
R7424:Ahrr UTSW 13 74257545 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCATGTGGAGAAGTGTGACC -3'
(R):5'- GACATGACCATGGAGGCTCATC -3'

Sequencing Primer
(F):5'- CCCTGGAGAAAATTCTGTGTAGATG -3'
(R):5'- TCCTTCCAGGAGAGCTGTTGAAAC -3'
Posted On2015-02-05