Incidental Mutation 'R3055:Xrcc4'
ID 265144
Institutional Source Beutler Lab
Gene Symbol Xrcc4
Ensembl Gene ENSMUSG00000021615
Gene Name X-ray repair complementing defective repair in Chinese hamster cells 4
Synonyms 2310057B22Rik
MMRRC Submission 040564-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.392) question?
Stock # R3055 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 89997033-90237727 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 90210196 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 83 (T83A)
Ref Sequence ENSEMBL: ENSMUSP00000124573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022115] [ENSMUST00000159199] [ENSMUST00000160232] [ENSMUST00000161396]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000022115
AA Change: T83A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022115
Gene: ENSMUSG00000021615
AA Change: T83A

DomainStartEndE-ValueType
Pfam:XRCC4 1 326 1.5e-153 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159199
AA Change: T83A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123934
Gene: ENSMUSG00000021615
AA Change: T83A

DomainStartEndE-ValueType
Pfam:XRCC4 1 310 2.7e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160232
AA Change: T83A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125486
Gene: ENSMUSG00000021615
AA Change: T83A

DomainStartEndE-ValueType
Pfam:XRCC4 1 94 4.8e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161396
AA Change: T83A

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000124573
Gene: ENSMUSG00000021615
AA Change: T83A

DomainStartEndE-ValueType
Pfam:XRCC4 1 83 5.4e-45 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene functions together with DNA ligase IV and the DNA-dependent protein kinase in the repair of DNA double-strand breaks. This protein plays a role in both non-homologous end joining and the completion of V(D)J recombination. Mutations in this gene can cause short stature, microcephaly, and endocrine dysfunction (SSMED). Alternative splicing generates several transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous null mutants have massive neuronal apoptosis, growth retardation, hypoplastic thymus and die by embryonic day 17.5. Lethality is rescued by Trp53 deficiency, but double knockout mice die from pro-B-cell lymphomas with Myc-Igh translocations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610042L04Rik A G 14: 4,348,878 (GRCm38) E13G probably damaging Het
5730596B20Rik A T 6: 52,156,108 (GRCm39) probably benign Het
Aadacl4fm4 A G 4: 144,401,268 (GRCm39) I72T probably benign Het
Abca16 A G 7: 120,035,074 (GRCm39) M287V probably benign Het
Abca7 G A 10: 79,835,581 (GRCm39) R283H probably damaging Het
Acad11 A G 9: 103,953,535 (GRCm39) I126V probably damaging Het
Ahrr A G 13: 74,373,006 (GRCm39) V148A probably damaging Het
Aldh1l2 T C 10: 83,338,336 (GRCm39) K528E probably benign Het
Atp6v0a2 T A 5: 124,765,209 (GRCm39) probably benign Het
Atxn10 A G 15: 85,271,206 (GRCm39) D248G probably benign Het
Bard1 A G 1: 71,127,390 (GRCm39) V73A possibly damaging Het
Catsper3 T C 13: 55,956,709 (GRCm39) S376P unknown Het
Ccdc150 A G 1: 54,328,001 (GRCm39) N361S possibly damaging Het
Cxcr6 A T 9: 123,639,529 (GRCm39) I177F probably damaging Het
Ddx25 A G 9: 35,462,647 (GRCm39) V246A probably damaging Het
Drd4 T C 7: 140,874,392 (GRCm39) V319A probably damaging Het
Dscam G A 16: 96,602,555 (GRCm39) T629I probably damaging Het
Evi5l C T 8: 4,241,603 (GRCm39) R311* probably null Het
Fxr1 A G 3: 34,103,333 (GRCm39) E221G probably damaging Het
Gldn A T 9: 54,245,807 (GRCm39) T453S probably damaging Het
Ighm T A 12: 113,382,596 (GRCm39) probably benign Het
Ints12 G A 3: 132,815,126 (GRCm39) M444I possibly damaging Het
Lgr5 T A 10: 115,302,028 (GRCm39) probably benign Het
Mier3 T A 13: 111,827,837 (GRCm39) D7E probably damaging Het
Mms19 A T 19: 41,938,527 (GRCm39) probably benign Het
Mrpl20 G T 4: 155,888,329 (GRCm39) V43F possibly damaging Het
Muc5b G T 7: 141,417,778 (GRCm39) V3575F probably damaging Het
Naip5 T C 13: 100,358,386 (GRCm39) Y950C probably benign Het
Or4d2 A G 11: 87,784,198 (GRCm39) V184A possibly damaging Het
Or5t9 T C 2: 86,659,471 (GRCm39) F125S possibly damaging Het
Or8b12b G T 9: 37,684,489 (GRCm39) C178F probably damaging Het
Pkd1l2 T A 8: 117,795,054 (GRCm39) probably null Het
Prune2 A G 19: 17,102,407 (GRCm39) E2522G probably damaging Het
Radil T C 5: 142,481,161 (GRCm39) T549A possibly damaging Het
Radx T A X: 138,412,306 (GRCm39) V439E possibly damaging Het
Rasa2 G A 9: 96,493,526 (GRCm39) L53F possibly damaging Het
Rasgrf2 A G 13: 92,165,583 (GRCm39) F306L probably damaging Het
Rbm19 C T 5: 120,271,075 (GRCm39) R633C probably damaging Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Shfl AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA 9: 20,785,013 (GRCm39) probably benign Het
Slc4a4 T A 5: 89,280,366 (GRCm39) L353H probably damaging Het
Slc4a4 T C 5: 89,373,807 (GRCm39) V971A probably damaging Het
Stil T A 4: 114,871,266 (GRCm39) probably benign Het
Tjp3 T C 10: 81,116,341 (GRCm39) K251R probably benign Het
Ugt2b35 A T 5: 87,149,457 (GRCm39) Y236F probably benign Het
Utp14b T A 1: 78,642,442 (GRCm39) D113E possibly damaging Het
Vmn1r121 G A 7: 20,832,390 (GRCm39) Q17* probably null Het
Vmn2r28 A T 7: 5,484,391 (GRCm39) L603Q probably damaging Het
Vps13b A G 15: 35,646,507 (GRCm39) E1537G probably damaging Het
Yae1d1 T C 13: 18,167,827 (GRCm39) E22G probably damaging Het
Other mutations in Xrcc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01376:Xrcc4 APN 13 90,210,169 (GRCm39) missense probably benign 0.00
IGL01486:Xrcc4 APN 13 90,210,151 (GRCm39) nonsense probably null
R0624:Xrcc4 UTSW 13 90,140,594 (GRCm39) missense possibly damaging 0.81
R0629:Xrcc4 UTSW 13 90,149,024 (GRCm39) splice site probably benign
R1801:Xrcc4 UTSW 13 90,140,698 (GRCm39) missense probably damaging 1.00
R2567:Xrcc4 UTSW 13 90,210,261 (GRCm39) missense probably damaging 0.99
R3056:Xrcc4 UTSW 13 90,210,196 (GRCm39) missense probably benign 0.06
R3941:Xrcc4 UTSW 13 90,219,752 (GRCm39) missense probably benign 0.01
R4486:Xrcc4 UTSW 13 90,140,707 (GRCm39) missense possibly damaging 0.79
R4556:Xrcc4 UTSW 13 90,140,623 (GRCm39) missense probably benign 0.02
R4599:Xrcc4 UTSW 13 90,210,126 (GRCm39) critical splice donor site probably null
R6057:Xrcc4 UTSW 13 90,139,198 (GRCm39) missense possibly damaging 0.95
R6262:Xrcc4 UTSW 13 89,926,906 (GRCm39) missense probably benign 0.00
R6597:Xrcc4 UTSW 13 90,149,048 (GRCm39) missense probably benign 0.24
R9080:Xrcc4 UTSW 13 90,149,097 (GRCm39) missense probably damaging 0.99
R9535:Xrcc4 UTSW 13 90,089,118 (GRCm39) missense probably benign 0.00
Z1176:Xrcc4 UTSW 13 90,089,161 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTATGACCATCACACATGTG -3'
(R):5'- TAGGACACAGGGGCTTCCAAAG -3'

Sequencing Primer
(F):5'- TGTGATGCAGCACACATACACAG -3'
(R):5'- AACGGGGTGCTTAACTAAGG -3'
Posted On 2015-02-05