Incidental Mutation 'I1329:Usf3'
ID26515
Institutional Source Beutler Lab
Gene Symbol Usf3
Ensembl Gene ENSMUSG00000068284
Gene Nameupstream transcription factor family member 3
SynonymsLOC207806, Gm608, LOC385650, 5530400K22Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.224) question?
Stock #I1329 (G1) of strain toku
Quality Score225
Status Validated (trace)
Chromosome16
Chromosomal Location44173246-44227465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 44220530 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 1791 (C1791F)
Ref Sequence ENSEMBL: ENSMUSP00000128627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119746] [ENSMUST00000169582]
Predicted Effect probably damaging
Transcript: ENSMUST00000119746
AA Change: C1791F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112620
Gene: ENSMUSG00000068284
AA Change: C1791F

DomainStartEndE-ValueType
HLH 24 75 4.26e-9 SMART
low complexity region 151 162 N/A INTRINSIC
low complexity region 246 262 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
low complexity region 399 413 N/A INTRINSIC
low complexity region 571 587 N/A INTRINSIC
low complexity region 765 782 N/A INTRINSIC
low complexity region 950 969 N/A INTRINSIC
low complexity region 1084 1100 N/A INTRINSIC
low complexity region 1370 1382 N/A INTRINSIC
low complexity region 1419 1437 N/A INTRINSIC
low complexity region 1527 1555 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169582
AA Change: C1791F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128627
Gene: ENSMUSG00000068284
AA Change: C1791F

DomainStartEndE-ValueType
HLH 24 75 4.26e-9 SMART
low complexity region 151 162 N/A INTRINSIC
low complexity region 246 262 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
low complexity region 399 413 N/A INTRINSIC
low complexity region 571 587 N/A INTRINSIC
low complexity region 765 782 N/A INTRINSIC
low complexity region 950 969 N/A INTRINSIC
low complexity region 1084 1100 N/A INTRINSIC
low complexity region 1370 1382 N/A INTRINSIC
low complexity region 1419 1437 N/A INTRINSIC
low complexity region 1527 1555 N/A INTRINSIC
Meta Mutation Damage Score 0.3990 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 95.2%
Validation Efficiency 89% (42/47)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,245,194 S542P probably benign Het
Adamts13 T C 2: 26,973,619 I28T possibly damaging Het
Agbl4 T A 4: 110,478,455 probably benign Het
Aspscr1 G C 11: 120,701,240 V268L probably damaging Het
Btbd10 A G 7: 113,332,875 S115P probably benign Het
Cercam T A 2: 29,871,085 V132E probably damaging Het
Decr1 G A 4: 15,930,976 R119* probably null Het
Dlst T C 12: 85,123,841 M248T probably damaging Het
Erbb3 T C 10: 128,583,454 N215S possibly damaging Het
Flnc G A 6: 29,451,415 V1543M probably damaging Het
Gk5 GCC GC 9: 96,140,629 probably null Het
Glrb T A 3: 80,862,074 R115S probably damaging Het
Gm5592 T A 7: 41,286,354 Y93* probably null Het
Gpr20 C T 15: 73,695,763 R259H probably damaging Het
Il1rap A G 16: 26,692,850 T215A probably benign Het
Ipmk T C 10: 71,381,447 C275R possibly damaging Het
Lats1 A G 10: 7,712,802 N1061S probably benign Het
Nkain3 A G 4: 20,158,329 probably benign Het
Nr1h4 A G 10: 89,483,362 probably benign Het
Nr4a3 A G 4: 48,051,585 Q142R probably benign Het
Otog G A 7: 46,246,503 V131I probably benign Het
Parp12 A T 6: 39,087,571 M627K probably damaging Het
Pcdh9 A G 14: 93,886,209 S842P probably benign Het
Phc2 G C 4: 128,711,113 G214A probably damaging Het
Prpf40a C A 2: 53,176,395 V92L probably benign Het
Qser1 A T 2: 104,786,977 Y1163* probably null Het
Rpe65 A G 3: 159,624,723 D509G probably benign Het
Scin T A 12: 40,073,330 N518I probably damaging Het
Sfswap G T 5: 129,507,137 probably benign Het
Tfpi A T 2: 84,444,116 N182K possibly damaging Het
Tph1 A G 7: 46,650,013 L368P probably damaging Het
Ttn T C 2: 76,741,572 T26326A possibly damaging Het
Ubr1 G A 2: 120,934,294 probably benign Het
Vmn1r16 T G 6: 57,323,534 R34S probably damaging Het
Ylpm1 C A 12: 85,040,880 P1604Q probably damaging Het
Zc3h12a A G 4: 125,119,364 V569A possibly damaging Het
Zmynd8 A G 2: 165,828,225 F488S probably damaging Het
Other mutations in Usf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Usf3 APN 16 44212637 splice site probably null
IGL01971:Usf3 APN 16 44217446 splice site probably null
IGL01982:Usf3 APN 16 44218817 missense possibly damaging 0.89
IGL02124:Usf3 APN 16 44219656 missense possibly damaging 0.82
IGL02309:Usf3 APN 16 44200663 missense probably benign 0.20
IGL02454:Usf3 APN 16 44217182 missense probably damaging 1.00
IGL02526:Usf3 APN 16 44220311 missense possibly damaging 0.89
IGL02671:Usf3 APN 16 44221781 missense probably damaging 1.00
IGL02800:Usf3 APN 16 44219096 missense probably benign 0.00
IGL02899:Usf3 APN 16 44221226 missense probably damaging 1.00
IGL03223:Usf3 APN 16 44216450 missense probably damaging 1.00
R0208:Usf3 UTSW 16 44216906 missense probably damaging 0.98
R0900:Usf3 UTSW 16 44215958 missense probably benign
R1160:Usf3 UTSW 16 44218547 missense probably damaging 1.00
R1417:Usf3 UTSW 16 44217449 missense probably benign 0.00
R1512:Usf3 UTSW 16 44221198 missense probably damaging 1.00
R1603:Usf3 UTSW 16 44218172 missense probably benign
R1702:Usf3 UTSW 16 44219632 nonsense probably null
R1774:Usf3 UTSW 16 44215670 missense probably damaging 1.00
R2344:Usf3 UTSW 16 44216051 missense probably benign
R2400:Usf3 UTSW 16 44215747 missense probably benign 0.04
R2484:Usf3 UTSW 16 44220682 missense probably damaging 0.99
R2570:Usf3 UTSW 16 44216381 missense probably benign 0.00
R3730:Usf3 UTSW 16 44218575 missense probably benign 0.00
R4024:Usf3 UTSW 16 44216165 missense possibly damaging 0.76
R4451:Usf3 UTSW 16 44217888 missense possibly damaging 0.76
R4883:Usf3 UTSW 16 44219579 missense probably damaging 1.00
R4895:Usf3 UTSW 16 44221096 missense possibly damaging 0.93
R4924:Usf3 UTSW 16 44217355 missense probably benign
R5020:Usf3 UTSW 16 44215526 missense probably damaging 1.00
R5034:Usf3 UTSW 16 44216399 missense probably damaging 1.00
R5053:Usf3 UTSW 16 44217187 missense probably benign 0.01
R5058:Usf3 UTSW 16 44212707 missense probably damaging 1.00
R5164:Usf3 UTSW 16 44218180 missense probably damaging 1.00
R5391:Usf3 UTSW 16 44217463 missense probably benign 0.01
R5407:Usf3 UTSW 16 44217406 missense probably benign 0.01
R5536:Usf3 UTSW 16 44217370 missense probably benign 0.16
R5805:Usf3 UTSW 16 44220746 missense possibly damaging 0.50
R5966:Usf3 UTSW 16 44220859 missense probably benign 0.14
R6024:Usf3 UTSW 16 44219840 missense probably damaging 1.00
R6122:Usf3 UTSW 16 44217307 missense probably damaging 0.99
R6180:Usf3 UTSW 16 44221105 missense probably damaging 1.00
R6362:Usf3 UTSW 16 44218577 missense probably benign 0.01
R6579:Usf3 UTSW 16 44218834 missense possibly damaging 0.54
R6874:Usf3 UTSW 16 44219740 missense probably benign 0.00
R7226:Usf3 UTSW 16 44220005 missense possibly damaging 0.54
R7379:Usf3 UTSW 16 44220576 missense probably benign 0.33
R7389:Usf3 UTSW 16 44217941 missense probably benign 0.09
R7452:Usf3 UTSW 16 44220034 missense probably benign 0.00
R7606:Usf3 UTSW 16 44218943 missense probably damaging 1.00
R7750:Usf3 UTSW 16 44220521 missense probably benign 0.15
R7765:Usf3 UTSW 16 44219063 missense probably benign 0.28
R7830:Usf3 UTSW 16 44219779 nonsense probably null
R7895:Usf3 UTSW 16 44216202 missense possibly damaging 0.67
R7941:Usf3 UTSW 16 44215561 missense probably damaging 1.00
R8280:Usf3 UTSW 16 44218501 missense probably benign 0.00
R8285:Usf3 UTSW 16 44220844 missense probably damaging 1.00
R8421:Usf3 UTSW 16 44217209 missense possibly damaging 0.67
R8692:Usf3 UTSW 16 44219740 missense probably benign 0.00
R8798:Usf3 UTSW 16 44220173 missense probably damaging 0.99
R8824:Usf3 UTSW 16 44215613 missense probably benign 0.12
X0057:Usf3 UTSW 16 44220784 missense probably benign 0.32
X0066:Usf3 UTSW 16 44220427 missense probably benign 0.00
Z1176:Usf3 UTSW 16 44220431 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- ACATTCAAACCAGGTGGAGCCAG -3'
(R):5'- GGTCAGCATTCCCATGAGACACAG -3'

Sequencing Primer
(F):5'- GTGGAGCCAGCCAACAG -3'
(R):5'- CCTGGGGTTAATTGCACCTAAAG -3'
Posted On2013-04-16