Incidental Mutation 'K7894:Rsph10b'
ID26516
Institutional Source Beutler Lab
Gene Symbol Rsph10b
Ensembl Gene ENSMUSG00000075569
Gene Nameradial spoke head 10 homolog B (Chlamydomonas)
SynonymsRsph10b2, 4930526H21Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #K7894 () of strain 468
Quality Score222
Status Validated (trace)
Chromosome5
Chromosomal Location143933035-143985719 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143944520 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 151 (D151G)
Ref Sequence ENSEMBL: ENSMUSP00000127770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166847] [ENSMUST00000169758]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000031618
Predicted Effect probably damaging
Transcript: ENSMUST00000166847
AA Change: D151G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132687
Gene: ENSMUSG00000075569
AA Change: D151G

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 39 50 N/A INTRINSIC
low complexity region 63 75 N/A INTRINSIC
MORN 107 128 5.9e-7 SMART
MORN 130 151 9.35e-1 SMART
MORN 153 174 1.23e0 SMART
MORN 177 198 1.84e0 SMART
MORN 202 223 3.21e1 SMART
MORN 225 246 1.67e-6 SMART
MORN 249 270 1.85e1 SMART
MORN 282 303 2.71e-6 SMART
MORN 305 326 3.53e-5 SMART
low complexity region 409 420 N/A INTRINSIC
low complexity region 629 649 N/A INTRINSIC
coiled coil region 787 841 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167009
Predicted Effect probably damaging
Transcript: ENSMUST00000169758
AA Change: D151G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127770
Gene: ENSMUSG00000075569
AA Change: D151G

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 39 50 N/A INTRINSIC
low complexity region 63 75 N/A INTRINSIC
Blast:MORN 84 105 7e-6 BLAST
MORN 107 128 5.9e-7 SMART
MORN 130 151 9.35e-1 SMART
MORN 153 174 1.23e0 SMART
Pfam:MORN 179 191 2.3e-2 PFAM
Meta Mutation Damage Score 0.3673 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 95.4%
Validation Efficiency 88% (22/25)
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C CAA 3: 122,147,868 probably null Het
Acsl4 C T X: 142,328,060 V632I probably benign Het
Adcy8 T C 15: 64,822,234 H398R probably benign Het
Catsperg1 C T 7: 29,197,154 probably benign Het
Ccpg1 T C 9: 73,001,877 probably null Het
Clk4 G T 11: 51,275,766 probably benign Het
Ehbp1 C T 11: 22,089,683 probably benign Het
Eri2 T C 7: 119,785,271 D669G probably benign Het
Nlrp9c A G 7: 26,384,898 S419P possibly damaging Het
Olfr652 A G 7: 104,564,532 T104A probably benign Het
Pde8a C A 7: 81,306,765 P304H probably damaging Het
Prmt3 A G 7: 49,826,711 Y356C probably damaging Het
Spryd3 A G 15: 102,118,141 V365A probably benign Het
Vmn1r58 T C 7: 5,410,703 N176S probably benign Het
Other mutations in Rsph10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Rsph10b APN 5 143937087 makesense probably null
R0136:Rsph10b UTSW 5 143959821 missense probably benign 0.05
R0149:Rsph10b UTSW 5 143938909 unclassified probably benign
R0326:Rsph10b UTSW 5 143967128 missense probably damaging 1.00
R0558:Rsph10b UTSW 5 143949338 missense probably benign 0.02
R1185:Rsph10b UTSW 5 143966462 splice site probably benign
R1185:Rsph10b UTSW 5 143966462 splice site probably benign
R1712:Rsph10b UTSW 5 143937149 missense probably damaging 0.96
R1832:Rsph10b UTSW 5 143967179 missense possibly damaging 0.79
R1909:Rsph10b UTSW 5 143985491 missense probably benign 0.09
R2044:Rsph10b UTSW 5 143967250 splice site probably null
R2155:Rsph10b UTSW 5 143961256 missense probably benign 0.05
R2842:Rsph10b UTSW 5 143979892 missense possibly damaging 0.81
R3805:Rsph10b UTSW 5 143958388 critical splice donor site probably null
R4031:Rsph10b UTSW 5 143985668 splice site probably null
R4792:Rsph10b UTSW 5 143937317 missense probably damaging 1.00
R4866:Rsph10b UTSW 5 143948529 missense probably benign 0.28
R6090:Rsph10b UTSW 5 143977128 missense probably benign 0.00
R6252:Rsph10b UTSW 5 143937121 missense possibly damaging 0.70
R6255:Rsph10b UTSW 5 143959746 missense probably damaging 1.00
R6518:Rsph10b UTSW 5 143963873 missense probably damaging 1.00
R7085:Rsph10b UTSW 5 143949284 missense possibly damaging 0.82
R7206:Rsph10b UTSW 5 143961192 missense possibly damaging 0.86
R7337:Rsph10b UTSW 5 143961215 missense probably benign 0.11
R7353:Rsph10b UTSW 5 143967220 missense possibly damaging 0.73
R7567:Rsph10b UTSW 5 143949426 missense possibly damaging 0.78
R8022:Rsph10b UTSW 5 143967232 missense probably benign 0.00
R8109:Rsph10b UTSW 5 143985530 missense probably benign 0.00
R8275:Rsph10b UTSW 5 143966505 missense possibly damaging 0.50
Z1177:Rsph10b UTSW 5 143977134 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCATGGTGTAAATGAAACCTTCCCAG -3'
(R):5'- TGTAAATCCACATACACAGTGGGCAG -3'

Sequencing Primer
(F):5'- TCCGTGCTGTGGAAGAAC -3'
(R):5'- gaggttggataatgatgatggttg -3'
Posted On2013-04-16