Incidental Mutation 'R3056:Utp14b'
ID265162
Institutional Source Beutler Lab
Gene Symbol Utp14b
Ensembl Gene ENSMUSG00000079470
Gene NameUTP14B small subunit processome component
Synonyms4932411L21Rik, jsd
MMRRC Submission 040565-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3056 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location78658038-78671512 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 78664725 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 113 (D113E)
Ref Sequence ENSEMBL: ENSMUSP00000121391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035779] [ENSMUST00000053760] [ENSMUST00000134566] [ENSMUST00000142704] [ENSMUST00000151622]
Predicted Effect probably benign
Transcript: ENSMUST00000035779
SMART Domains Protein: ENSMUSP00000045291
Gene: ENSMUSG00000032883

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 113 587 2e-94 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000053760
AA Change: D113E

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000052149
Gene: ENSMUSG00000079470
AA Change: D113E

DomainStartEndE-ValueType
Pfam:Utp14 39 744 6.4e-205 PFAM
low complexity region 758 778 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134566
SMART Domains Protein: ENSMUSP00000117952
Gene: ENSMUSG00000032883

DomainStartEndE-ValueType
Pfam:AMP-binding 1 435 4.3e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142704
SMART Domains Protein: ENSMUSP00000121695
Gene: ENSMUSG00000032883

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 113 587 2.5e-106 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000151622
AA Change: D113E

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121391
Gene: ENSMUSG00000079470
AA Change: D113E

DomainStartEndE-ValueType
Pfam:Utp14 45 743 6e-163 PFAM
low complexity region 758 778 N/A INTRINSIC
Meta Mutation Damage Score 0.3247 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous males are sterile with spermatogonial arrest and elevated intratesticular testosterone levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik A T 5: 5,457,283 probably null Het
2410015M20Rik A G 17: 56,608,889 F55S probably damaging Het
2410089E03Rik T C 15: 8,251,007 S2805P unknown Het
Abca1 A T 4: 53,127,626 M131K probably benign Het
Agbl1 C T 7: 76,766,484 T751M possibly damaging Het
Asb14 A G 14: 26,914,189 I510V possibly damaging Het
Bard1 A G 1: 71,088,231 V73A possibly damaging Het
C6 T C 15: 4,739,873 I187T probably damaging Het
Catsper3 T C 13: 55,808,896 S376P unknown Het
Ccdc150 A G 1: 54,288,842 N361S possibly damaging Het
Cntn5 A G 9: 10,419,071 L7P probably benign Het
Cxcr6 A T 9: 123,810,464 I177F probably damaging Het
Dnah7b A G 1: 46,268,709 D3061G possibly damaging Het
Epas1 T C 17: 86,830,981 F835S probably damaging Het
Fat3 C T 9: 15,960,496 R3533H probably benign Het
Fxr1 A G 3: 34,049,184 E221G probably damaging Het
Gm436 A G 4: 144,674,698 I72T probably benign Het
Gpatch11 A G 17: 78,843,843 T228A probably damaging Het
Greb1 G T 12: 16,688,591 T1457K probably damaging Het
Ighm T A 12: 113,418,976 probably benign Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Lmx1b G A 2: 33,567,285 Q168* probably null Het
Ltbp3 C A 19: 5,751,406 N659K probably benign Het
Mrpl20 G T 4: 155,803,872 V43F possibly damaging Het
Nlgn1 T C 3: 25,433,696 N825S possibly damaging Het
Olfr1087 C A 2: 86,690,552 C141F possibly damaging Het
Olfr1163 T A 2: 88,071,239 T48S probably benign Het
Olfr492 A T 7: 108,323,550 V42E possibly damaging Het
Pccb C T 9: 101,030,197 R79Q probably damaging Het
Peg10 G A 6: 4,755,029 R270H possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc4a4 T C 5: 89,225,948 V971A probably damaging Het
Timm29 T C 9: 21,593,591 M185T probably damaging Het
Tmem92 C T 11: 94,779,047 C86Y probably benign Het
Tnfrsf8 C T 4: 145,285,325 probably null Het
Tnks1bp1 T A 2: 85,070,000 C1433* probably null Het
Vmn2r110 T A 17: 20,583,098 Y405F probably damaging Het
Wiz A G 17: 32,357,697 S628P probably benign Het
Xrcc4 T C 13: 90,062,077 T83A probably benign Het
Other mutations in Utp14b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Utp14b APN 1 78664545 missense probably damaging 1.00
IGL01837:Utp14b APN 1 78664919 missense probably damaging 1.00
IGL02895:Utp14b APN 1 78664607 missense possibly damaging 0.61
IGL03165:Utp14b APN 1 78664520 missense probably damaging 0.97
IGL03210:Utp14b APN 1 78665551 missense probably benign 0.02
R0662:Utp14b UTSW 1 78664999 missense probably damaging 1.00
R0671:Utp14b UTSW 1 78664735 missense probably benign 0.00
R0736:Utp14b UTSW 1 78665272 missense probably damaging 1.00
R1180:Utp14b UTSW 1 78665445 missense probably damaging 1.00
R1430:Utp14b UTSW 1 78666394 missense probably benign 0.25
R1448:Utp14b UTSW 1 78665445 missense probably damaging 1.00
R1641:Utp14b UTSW 1 78665939 missense probably benign 0.08
R1867:Utp14b UTSW 1 78665431 missense probably damaging 1.00
R3054:Utp14b UTSW 1 78664725 missense possibly damaging 0.91
R3055:Utp14b UTSW 1 78664725 missense possibly damaging 0.91
R3426:Utp14b UTSW 1 78665339 missense probably damaging 1.00
R3744:Utp14b UTSW 1 78665256 missense probably benign 0.03
R4204:Utp14b UTSW 1 78664822 missense probably benign 0.12
R5570:Utp14b UTSW 1 78665401 missense probably damaging 1.00
R5574:Utp14b UTSW 1 78666409 missense probably damaging 1.00
R5958:Utp14b UTSW 1 78664942 nonsense probably null
R5958:Utp14b UTSW 1 78664943 missense probably damaging 1.00
R6173:Utp14b UTSW 1 78665837 missense probably benign 0.03
R6173:Utp14b UTSW 1 78665840 missense probably benign 0.00
R7258:Utp14b UTSW 1 78664974 missense probably benign 0.30
R7784:Utp14b UTSW 1 78664943 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AACTATCCACTGAGTACGAGTG -3'
(R):5'- AAAATCAACTGCTCTGCCTGC -3'

Sequencing Primer
(F):5'- CTATCCACTGAGTACGAGTGAAGATG -3'
(R):5'- GTTCTTCAGAACCACCGGATC -3'
Posted On2015-02-05