Incidental Mutation 'R3056:Olfr1087'
ID265165
Institutional Source Beutler Lab
Gene Symbol Olfr1087
Ensembl Gene ENSMUSG00000075174
Gene Nameolfactory receptor 1087
SynonymsGA_x6K02T2Q125-48182406-48181465, MOR188-5
MMRRC Submission 040565-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R3056 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86687235-86698395 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 86690552 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 141 (C141F)
Ref Sequence ENSEMBL: ENSMUSP00000149439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099877] [ENSMUST00000214141]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099877
AA Change: C141F

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097462
Gene: ENSMUSG00000075174
AA Change: C141F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.5e-49 PFAM
Pfam:7tm_1 41 290 1.7e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214141
AA Change: C141F

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik A T 5: 5,457,283 probably null Het
2410015M20Rik A G 17: 56,608,889 F55S probably damaging Het
2410089E03Rik T C 15: 8,251,007 S2805P unknown Het
Abca1 A T 4: 53,127,626 M131K probably benign Het
Agbl1 C T 7: 76,766,484 T751M possibly damaging Het
Asb14 A G 14: 26,914,189 I510V possibly damaging Het
Bard1 A G 1: 71,088,231 V73A possibly damaging Het
C6 T C 15: 4,739,873 I187T probably damaging Het
Catsper3 T C 13: 55,808,896 S376P unknown Het
Ccdc150 A G 1: 54,288,842 N361S possibly damaging Het
Cntn5 A G 9: 10,419,071 L7P probably benign Het
Cxcr6 A T 9: 123,810,464 I177F probably damaging Het
Dnah7b A G 1: 46,268,709 D3061G possibly damaging Het
Epas1 T C 17: 86,830,981 F835S probably damaging Het
Fat3 C T 9: 15,960,496 R3533H probably benign Het
Fxr1 A G 3: 34,049,184 E221G probably damaging Het
Gm436 A G 4: 144,674,698 I72T probably benign Het
Gpatch11 A G 17: 78,843,843 T228A probably damaging Het
Greb1 G T 12: 16,688,591 T1457K probably damaging Het
Ighm T A 12: 113,418,976 probably benign Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Lmx1b G A 2: 33,567,285 Q168* probably null Het
Ltbp3 C A 19: 5,751,406 N659K probably benign Het
Mrpl20 G T 4: 155,803,872 V43F possibly damaging Het
Nlgn1 T C 3: 25,433,696 N825S possibly damaging Het
Olfr1163 T A 2: 88,071,239 T48S probably benign Het
Olfr492 A T 7: 108,323,550 V42E possibly damaging Het
Pccb C T 9: 101,030,197 R79Q probably damaging Het
Peg10 G A 6: 4,755,029 R270H possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc4a4 T C 5: 89,225,948 V971A probably damaging Het
Timm29 T C 9: 21,593,591 M185T probably damaging Het
Tmem92 C T 11: 94,779,047 C86Y probably benign Het
Tnfrsf8 C T 4: 145,285,325 probably null Het
Tnks1bp1 T A 2: 85,070,000 C1433* probably null Het
Utp14b T A 1: 78,664,725 D113E possibly damaging Het
Vmn2r110 T A 17: 20,583,098 Y405F probably damaging Het
Wiz A G 17: 32,357,697 S628P probably benign Het
Xrcc4 T C 13: 90,062,077 T83A probably benign Het
Other mutations in Olfr1087
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01747:Olfr1087 APN 2 86690701 missense possibly damaging 0.90
IGL02300:Olfr1087 APN 2 86690652 missense probably benign 0.43
IGL03259:Olfr1087 APN 2 86690550 missense probably benign 0.00
IGL03404:Olfr1087 APN 2 86690028 utr 3 prime probably benign
R1430:Olfr1087 UTSW 2 86690522 missense possibly damaging 0.91
R1513:Olfr1087 UTSW 2 86690797 missense possibly damaging 0.60
R1529:Olfr1087 UTSW 2 86690333 missense possibly damaging 0.69
R1767:Olfr1087 UTSW 2 86690384 missense probably benign 0.01
R1869:Olfr1087 UTSW 2 86690391 missense probably damaging 0.98
R5002:Olfr1087 UTSW 2 86690085 missense possibly damaging 0.95
R7303:Olfr1087 UTSW 2 86690822 missense probably benign 0.05
X0063:Olfr1087 UTSW 2 86690543 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCGAGTTCATTCTGAGAATGGC -3'
(R):5'- AGCTGTGGGACCTAAGATGTTG -3'

Sequencing Primer
(F):5'- GTTCATTCTGAGAATGGCTATAAGG -3'
(R):5'- GGGACCTAAGATGTTGGTAAATTTTG -3'
Posted On2015-02-05