Incidental Mutation 'R3056:Olfr1163'
ID265166
Institutional Source Beutler Lab
Gene Symbol Olfr1163
Ensembl Gene ENSMUSG00000075137
Gene Nameolfactory receptor 1163
SynonymsMOR174-8, GA_x6K02T2Q125-49563265-49562315
MMRRC Submission 040565-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R3056 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location88069817-88071830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88071239 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 48 (T48S)
Ref Sequence ENSEMBL: ENSMUSP00000149399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099835] [ENSMUST00000215268]
Predicted Effect probably benign
Transcript: ENSMUST00000099835
AA Change: T48S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097423
Gene: ENSMUSG00000075137
AA Change: T48S

DomainStartEndE-ValueType
Pfam:7tm_4 33 310 1.2e-44 PFAM
Pfam:7tm_1 43 292 2.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215268
AA Change: T48S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik A T 5: 5,457,283 probably null Het
2410015M20Rik A G 17: 56,608,889 F55S probably damaging Het
2410089E03Rik T C 15: 8,251,007 S2805P unknown Het
Abca1 A T 4: 53,127,626 M131K probably benign Het
Agbl1 C T 7: 76,766,484 T751M possibly damaging Het
Asb14 A G 14: 26,914,189 I510V possibly damaging Het
Bard1 A G 1: 71,088,231 V73A possibly damaging Het
C6 T C 15: 4,739,873 I187T probably damaging Het
Catsper3 T C 13: 55,808,896 S376P unknown Het
Ccdc150 A G 1: 54,288,842 N361S possibly damaging Het
Cntn5 A G 9: 10,419,071 L7P probably benign Het
Cxcr6 A T 9: 123,810,464 I177F probably damaging Het
Dnah7b A G 1: 46,268,709 D3061G possibly damaging Het
Epas1 T C 17: 86,830,981 F835S probably damaging Het
Fat3 C T 9: 15,960,496 R3533H probably benign Het
Fxr1 A G 3: 34,049,184 E221G probably damaging Het
Gm436 A G 4: 144,674,698 I72T probably benign Het
Gpatch11 A G 17: 78,843,843 T228A probably damaging Het
Greb1 G T 12: 16,688,591 T1457K probably damaging Het
Ighm T A 12: 113,418,976 probably benign Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Lmx1b G A 2: 33,567,285 Q168* probably null Het
Ltbp3 C A 19: 5,751,406 N659K probably benign Het
Mrpl20 G T 4: 155,803,872 V43F possibly damaging Het
Nlgn1 T C 3: 25,433,696 N825S possibly damaging Het
Olfr1087 C A 2: 86,690,552 C141F possibly damaging Het
Olfr492 A T 7: 108,323,550 V42E possibly damaging Het
Pccb C T 9: 101,030,197 R79Q probably damaging Het
Peg10 G A 6: 4,755,029 R270H possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc4a4 T C 5: 89,225,948 V971A probably damaging Het
Timm29 T C 9: 21,593,591 M185T probably damaging Het
Tmem92 C T 11: 94,779,047 C86Y probably benign Het
Tnfrsf8 C T 4: 145,285,325 probably null Het
Tnks1bp1 T A 2: 85,070,000 C1433* probably null Het
Utp14b T A 1: 78,664,725 D113E possibly damaging Het
Vmn2r110 T A 17: 20,583,098 Y405F probably damaging Het
Wiz A G 17: 32,357,697 S628P probably benign Het
Xrcc4 T C 13: 90,062,077 T83A probably benign Het
Other mutations in Olfr1163
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01447:Olfr1163 APN 2 88071124 missense possibly damaging 0.56
IGL01472:Olfr1163 APN 2 88070978 missense possibly damaging 0.56
IGL02111:Olfr1163 APN 2 88071227 missense probably benign 0.22
R1274:Olfr1163 UTSW 2 88070595 missense probably damaging 1.00
R1938:Olfr1163 UTSW 2 88070956 missense probably damaging 1.00
R2012:Olfr1163 UTSW 2 88070719 missense probably benign 0.03
R4127:Olfr1163 UTSW 2 88071235 missense probably benign 0.00
R4748:Olfr1163 UTSW 2 88070612 missense probably benign 0.44
R4749:Olfr1163 UTSW 2 88070612 missense probably benign 0.44
R4769:Olfr1163 UTSW 2 88070729 missense probably benign 0.25
R6647:Olfr1163 UTSW 2 88070709 missense probably benign 0.03
R7111:Olfr1163 UTSW 2 88070656 missense probably damaging 1.00
R7168:Olfr1163 UTSW 2 88070577 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- AGCGATCATAAGCCATAACTGC -3'
(R):5'- GGCAAGTCTTCTGTCTCAGCTG -3'

Sequencing Primer
(F):5'- GCCATAACTGCTAGTAAGTAGGACTC -3'
(R):5'- TGTCCACTATGGTGCCACTGG -3'
Posted On2015-02-05