Incidental Mutation 'R3056:Ints12'
ID265169
Institutional Source Beutler Lab
Gene Symbol Ints12
Ensembl Gene ENSMUSG00000028016
Gene Nameintegrator complex subunit 12
SynonymsPhf22, 2810027J24Rik, 1110020M19Rik, 4930529N21Rik, A230056J18Rik
MMRRC Submission 040565-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3056 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location133091840-133110988 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 133109365 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 444 (M444I)
Ref Sequence ENSEMBL: ENSMUSP00000029650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029650] [ENSMUST00000147041]
PDB Structure
Solution structure of PHD domain in protein NP_082203 [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029650
AA Change: M444I

PolyPhen 2 Score 0.595 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029650
Gene: ENSMUSG00000028016
AA Change: M444I

DomainStartEndE-ValueType
internal_repeat_1 23 67 4.54e-5 PROSPERO
low complexity region 74 82 N/A INTRINSIC
internal_repeat_1 91 139 4.54e-5 PROSPERO
PHD 160 212 4.63e-9 SMART
low complexity region 219 240 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
low complexity region 337 373 N/A INTRINSIC
low complexity region 381 436 N/A INTRINSIC
low complexity region 451 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147041
SMART Domains Protein: ENSMUSP00000114238
Gene: ENSMUSG00000040969

DomainStartEndE-ValueType
low complexity region 34 49 N/A INTRINSIC
RhoGEF 98 284 2.72e-33 SMART
low complexity region 296 312 N/A INTRINSIC
BAR 315 514 4.8e-29 SMART
SH3 584 643 5.56e-1 SMART
low complexity region 678 689 N/A INTRINSIC
SH3 709 768 1.95e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160669
Meta Mutation Damage Score 0.1323 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS12 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik A T 5: 5,457,283 probably null Het
2410015M20Rik A G 17: 56,608,889 F55S probably damaging Het
2410089E03Rik T C 15: 8,251,007 S2805P unknown Het
Abca1 A T 4: 53,127,626 M131K probably benign Het
Agbl1 C T 7: 76,766,484 T751M possibly damaging Het
Asb14 A G 14: 26,914,189 I510V possibly damaging Het
Bard1 A G 1: 71,088,231 V73A possibly damaging Het
C6 T C 15: 4,739,873 I187T probably damaging Het
Catsper3 T C 13: 55,808,896 S376P unknown Het
Ccdc150 A G 1: 54,288,842 N361S possibly damaging Het
Cntn5 A G 9: 10,419,071 L7P probably benign Het
Cxcr6 A T 9: 123,810,464 I177F probably damaging Het
Dnah7b A G 1: 46,268,709 D3061G possibly damaging Het
Epas1 T C 17: 86,830,981 F835S probably damaging Het
Fat3 C T 9: 15,960,496 R3533H probably benign Het
Fxr1 A G 3: 34,049,184 E221G probably damaging Het
Gm436 A G 4: 144,674,698 I72T probably benign Het
Gpatch11 A G 17: 78,843,843 T228A probably damaging Het
Greb1 G T 12: 16,688,591 T1457K probably damaging Het
Ighm T A 12: 113,418,976 probably benign Het
Lmx1b G A 2: 33,567,285 Q168* probably null Het
Ltbp3 C A 19: 5,751,406 N659K probably benign Het
Mrpl20 G T 4: 155,803,872 V43F possibly damaging Het
Nlgn1 T C 3: 25,433,696 N825S possibly damaging Het
Olfr1087 C A 2: 86,690,552 C141F possibly damaging Het
Olfr1163 T A 2: 88,071,239 T48S probably benign Het
Olfr492 A T 7: 108,323,550 V42E possibly damaging Het
Pccb C T 9: 101,030,197 R79Q probably damaging Het
Peg10 G A 6: 4,755,029 R270H possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc4a4 T C 5: 89,225,948 V971A probably damaging Het
Timm29 T C 9: 21,593,591 M185T probably damaging Het
Tmem92 C T 11: 94,779,047 C86Y probably benign Het
Tnfrsf8 C T 4: 145,285,325 probably null Het
Tnks1bp1 T A 2: 85,070,000 C1433* probably null Het
Utp14b T A 1: 78,664,725 D113E possibly damaging Het
Vmn2r110 T A 17: 20,583,098 Y405F probably damaging Het
Wiz A G 17: 32,357,697 S628P probably benign Het
Xrcc4 T C 13: 90,062,077 T83A probably benign Het
Other mutations in Ints12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Ints12 APN 3 133100809 critical splice donor site probably null
R0243:Ints12 UTSW 3 133109045 missense probably benign 0.37
R0847:Ints12 UTSW 3 133108842 missense possibly damaging 0.72
R2118:Ints12 UTSW 3 133109160 missense probably damaging 0.98
R2323:Ints12 UTSW 3 133109365 missense possibly damaging 0.60
R2324:Ints12 UTSW 3 133109365 missense possibly damaging 0.60
R2384:Ints12 UTSW 3 133109103 unclassified probably null
R3055:Ints12 UTSW 3 133109365 missense possibly damaging 0.60
R3919:Ints12 UTSW 3 133100683 missense probably benign
R4431:Ints12 UTSW 3 133102481 missense probably damaging 1.00
R4594:Ints12 UTSW 3 133108868 missense probably benign 0.00
R4598:Ints12 UTSW 3 133098453 missense probably benign
R4599:Ints12 UTSW 3 133098453 missense probably benign
R4702:Ints12 UTSW 3 133096785 missense probably damaging 1.00
R5083:Ints12 UTSW 3 133100777 missense possibly damaging 0.54
R5507:Ints12 UTSW 3 133109160 missense probably damaging 1.00
R5894:Ints12 UTSW 3 133098558 missense probably damaging 1.00
R6647:Ints12 UTSW 3 133096878 missense possibly damaging 0.88
R8245:Ints12 UTSW 3 133108872 missense probably benign
Z1176:Ints12 UTSW 3 133102464 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGGGTCTTCCTAGTCCTAG -3'
(R):5'- AAGCTCTTGTCATGCATCAGTC -3'

Sequencing Primer
(F):5'- CCTAGTCCTAGTAGTTTAGTTCCTGG -3'
(R):5'- TGTCATGCATCAGTCATTATAATCAC -3'
Posted On2015-02-05